Moc11g29370 (gene) Bitter gourd (OHB3-1) v2
Overview
Sequences
The following sequences are available for this feature:
Legend: exonCDSpolypeptide Hold the cursor over a type above to highlight its positions in the sequence below.ATGGAAGGACAAGAAGATGTATTTGGAACTGCAGACAGTTTGGGTGAGGGAAAGGTGGAGGAGCATCCTGTTGAAATCAAGGCCTTGTTTTTCGCTCGGGCTCGAGATCTCACGGGCATGAACGACCTCGTATTAGAGGTCCCATCAGGCAGTACTGCCAAGGATTGTTTGAACAAGATTGTAGGCAGATTTCCAAGGCTGGAAGAGATAGTTGGATGTGTGGTTCTGGCTCTGAACGAGGATTATACAACTGAGTCAACAATTGTTAAAGACAAAGACGAGTTGGCAATTATCCCTCCCATAAGTGGTGGCTAA ATGGAAGGACAAGAAGATGTATTTGGAACTGCAGACAGTTTGGGTGAGGGAAAGGTGGAGGAGCATCCTGTTGAAATCAAGGCCTTGTTTTTCGCTCGGGCTCGAGATCTCACGGGCATGAACGACCTCGTATTAGAGGTCCCATCAGGCAGTACTGCCAAGGATTGTTTGAACAAGATTGTAGGCAGATTTCCAAGGCTGGAAGAGATAGTTGGATGTGTGGTTCTGGCTCTGAACGAGGATTATACAACTGAGTCAACAATTGTTAAAGACAAAGACGAGTTGGCAATTATCCCTCCCATAAGTGGTGGCTAA ATGGAAGGACAAGAAGATGTATTTGGAACTGCAGACAGTTTGGGTGAGGGAAAGGTGGAGGAGCATCCTGTTGAAATCAAGGCCTTGTTTTTCGCTCGGGCTCGAGATCTCACGGGCATGAACGACCTCGTATTAGAGGTCCCATCAGGCAGTACTGCCAAGGATTGTTTGAACAAGATTGTAGGCAGATTTCCAAGGCTGGAAGAGATAGTTGGATGTGTGGTTCTGGCTCTGAACGAGGATTATACAACTGAGTCAACAATTGTTAAAGACAAAGACGAGTTGGCAATTATCCCTCCCATAAGTGGTGGCTAA MEGQEDVFGTADSLGEGKVEEHPVEIKALFFARARDLTGMNDLVLEVPSGSTAKDCLNKIVGRFPRLEEIVGCVVLALNEDYTTESTIVKDKDELAIIPPISGG Homology
BLAST of Moc11g29370 vs. NCBI nr
Match: XP_022141756.1 (molybdopterin synthase sulfur carrier subunit [Momordica charantia] >XP_022141757.1 molybdopterin synthase sulfur carrier subunit [Momordica charantia] >XP_022141758.1 molybdopterin synthase sulfur carrier subunit [Momordica charantia] >XP_022141759.1 molybdopterin synthase sulfur carrier subunit [Momordica charantia]) HSP 1 Score: 211.5 bits (537), Expect = 3.6e-51 Identity = 104/104 (100.00%), Postives = 104/104 (100.00%), Query Frame = 0
BLAST of Moc11g29370 vs. NCBI nr
Match: XP_023522482.1 (molybdopterin synthase sulfur carrier subunit [Cucurbita pepo subsp. pepo]) HSP 1 Score: 180.6 bits (457), Expect = 6.7e-42 Identity = 91/104 (87.50%), Postives = 99/104 (95.19%), Query Frame = 0
BLAST of Moc11g29370 vs. NCBI nr
Match: XP_022932461.1 (molybdopterin synthase sulfur carrier subunit [Cucurbita moschata] >KAG6607527.1 Molybdopterin synthase sulfur carrier subunit, partial [Cucurbita argyrosperma subsp. sororia]) HSP 1 Score: 174.5 bits (441), Expect = 4.8e-40 Identity = 88/104 (84.62%), Postives = 97/104 (93.27%), Query Frame = 0
BLAST of Moc11g29370 vs. NCBI nr
Match: KAG7037169.1 (Molybdopterin synthase sulfur carrier subunit, partial [Cucurbita argyrosperma subsp. argyrosperma]) HSP 1 Score: 174.5 bits (441), Expect = 4.8e-40 Identity = 88/104 (84.62%), Postives = 97/104 (93.27%), Query Frame = 0
BLAST of Moc11g29370 vs. NCBI nr
Match: XP_022973403.1 (molybdopterin synthase sulfur carrier subunit [Cucurbita maxima]) HSP 1 Score: 172.6 bits (436), Expect = 1.8e-39 Identity = 88/104 (84.62%), Postives = 97/104 (93.27%), Query Frame = 0
BLAST of Moc11g29370 vs. ExPASy Swiss-Prot
Match: Q9S7A3 (Molybdopterin synthase sulfur carrier subunit OS=Arabidopsis thaliana OX=3702 GN=At4g10100 PE=3 SV=1) HSP 1 Score: 117.5 bits (293), Expect = 9.2e-26 Identity = 55/81 (67.90%), Postives = 69/81 (85.19%), Query Frame = 0
BLAST of Moc11g29370 vs. ExPASy Swiss-Prot
Match: B6SXF8 (Molybdopterin synthase sulfur carrier subunit OS=Zea mays OX=4577 GN=VP15 PE=2 SV=1) HSP 1 Score: 110.2 bits (274), Expect = 1.5e-23 Identity = 51/79 (64.56%), Postives = 63/79 (79.75%), Query Frame = 0
BLAST of Moc11g29370 vs. ExPASy Swiss-Prot
Match: A2X635 (Molybdopterin synthase sulfur carrier subunit OS=Oryza sativa subsp. indica OX=39946 GN=OsI_07667 PE=3 SV=1) HSP 1 Score: 108.6 bits (270), Expect = 4.3e-23 Identity = 52/81 (64.20%), Postives = 63/81 (77.78%), Query Frame = 0
BLAST of Moc11g29370 vs. ExPASy Swiss-Prot
Match: Q6YVX4 (Molybdopterin synthase sulfur carrier subunit OS=Oryza sativa subsp. japonica OX=39947 GN=Os02g0558300 PE=3 SV=1) HSP 1 Score: 108.6 bits (270), Expect = 4.3e-23 Identity = 52/81 (64.20%), Postives = 63/81 (77.78%), Query Frame = 0
BLAST of Moc11g29370 vs. ExPASy Swiss-Prot
Match: A8JJB2 (Molybdopterin synthase sulfur carrier subunit OS=Chlamydomonas reinhardtii OX=3055 GN=CHLREDRAFT_109356 PE=3 SV=1) HSP 1 Score: 72.8 bits (177), Expect = 2.6e-12 Identity = 32/83 (38.55%), Postives = 55/83 (66.27%), Query Frame = 0
BLAST of Moc11g29370 vs. ExPASy TrEMBL
Match: A0A6J1CKR6 (Molybdopterin synthase sulfur carrier subunit OS=Momordica charantia OX=3673 GN=LOC111012042 PE=3 SV=1) HSP 1 Score: 211.5 bits (537), Expect = 1.7e-51 Identity = 104/104 (100.00%), Postives = 104/104 (100.00%), Query Frame = 0
BLAST of Moc11g29370 vs. ExPASy TrEMBL
Match: A0A6J1EWF4 (Molybdopterin synthase sulfur carrier subunit OS=Cucurbita moschata OX=3662 GN=LOC111438870 PE=3 SV=1) HSP 1 Score: 174.5 bits (441), Expect = 2.3e-40 Identity = 88/104 (84.62%), Postives = 97/104 (93.27%), Query Frame = 0
BLAST of Moc11g29370 vs. ExPASy TrEMBL
Match: A0A6J1ICY6 (Molybdopterin synthase sulfur carrier subunit OS=Cucurbita maxima OX=3661 GN=LOC111471951 PE=3 SV=1) HSP 1 Score: 172.6 bits (436), Expect = 8.9e-40 Identity = 88/104 (84.62%), Postives = 97/104 (93.27%), Query Frame = 0
BLAST of Moc11g29370 vs. ExPASy TrEMBL
Match: A0A1S4E2J1 (Molybdopterin synthase sulfur carrier subunit OS=Cucumis melo OX=3656 GN=LOC103498674 PE=3 SV=1) HSP 1 Score: 164.1 bits (414), Expect = 3.2e-37 Identity = 81/104 (77.88%), Postives = 92/104 (88.46%), Query Frame = 0
BLAST of Moc11g29370 vs. ExPASy TrEMBL
Match: A0A5A7TCZ4 (Molybdopterin synthase sulfur carrier subunit OS=Cucumis melo var. makuwa OX=1194695 GN=E5676_scaffold169G00780 PE=3 SV=1) HSP 1 Score: 159.5 bits (402), Expect = 7.8e-36 Identity = 79/102 (77.45%), Postives = 90/102 (88.24%), Query Frame = 0
BLAST of Moc11g29370 vs. TAIR 10
Match: AT4G10100.1 (co-factor for nitrate, reductase and xanthine dehydrogenase 7 ) HSP 1 Score: 117.5 bits (293), Expect = 6.5e-27 Identity = 55/81 (67.90%), Postives = 69/81 (85.19%), Query Frame = 0
BLAST of Moc11g29370 vs. TAIR 10
Match: AT4G10100.2 (co-factor for nitrate, reductase and xanthine dehydrogenase 7 ) HSP 1 Score: 117.5 bits (293), Expect = 6.5e-27 Identity = 55/81 (67.90%), Postives = 69/81 (85.19%), Query Frame = 0
BLAST of Moc11g29370 vs. TAIR 10
Match: AT4G10100.3 (co-factor for nitrate, reductase and xanthine dehydrogenase 7 ) HSP 1 Score: 117.5 bits (293), Expect = 6.5e-27 Identity = 55/81 (67.90%), Postives = 69/81 (85.19%), Query Frame = 0
The following BLAST results are available for this feature:
InterPro
Analysis Name: InterPro Annotations of Bitter gourd (OHB3-1) v2
Date Performed: 2022-08-01
Relationships
The following mRNA feature(s) are a part of this gene:
GO Annotation
GO Assignments
This gene is annotated with the following GO terms.
|