Sequences
The following sequences are available for this feature:
Gene sequence (with intron) Legend: CDSpolypeptide Hold the cursor over a type above to highlight its positions in the sequence below. CATCCATTTTTTGGACTAGTTGACTCGGCCGGTGAGTGTTGGGAATTTAGT mRNA sequence CATCCATTTTTTGGACTAGTTGACTCGGCCGGTGAGTGTTGGGAATTTAGT Coding sequence (CDS) CATCCATTTTTTGGACTAGTTGACTCGGCCGGTGAGTGTTGGGAATTTAGT Protein sequence
Homology
The following BLAST results are available for this feature:
Match Name | E-value | Identity | Description | |
Match Name | E-value | Identity | Description | |
Match Name | E-value | Identity | Description | |
Match Name | E-value | Identity | Description | |
Relationships
The following mRNA feature(s) are a part of this gene:
Feature Name | Unique Name | Type |
MS023034.1 | MS023034.1 | mRNA |
|