
Csor.00g241240 (gene) Silver-seed gourd (wild; sororia) v1
Overview
Sequences
The following sequences are available for this feature:
Legend: CDSsinglepolypeptidestart_codonstop_codon Hold the cursor over a type above to highlight its positions in the sequence below.ATGGTAACAGCTGGCGTTTTCATGATAGCCAGGTGCTCCCCTTTATTTGAATACCCGCCTACGACTTTGATTGTTATTACTTCTACAGGAGCTACAACGTCATTCCTTGCGGCAACCATTGGAATATTACAGAATGATCTAAAGAGGGTCCTAGCTTATTCAACTTGCAGTCAATTAGGCTATATGATCTTTGCTTGCGGCATCTCTAACTATTCGGTTAGCGTCTTTCACTTAATGAATCACGCGTTTTTCAAAGCATTACTATTCCTGAGTGTAGGTTCAGTGATTCATGCCACGTCGGATGAGCAAGATATGCGGAAGAGGGGCTTGCCTCCTGTTCCCTTTTACCTATGTCATGATGCTCATGGGTAG ATGGTAACAGCTGGCGTTTTCATGATAGCCAGGTGCTCCCCTTTATTTGAATACCCGCCTACGACTTTGATTGTTATTACTTCTACAGGAGCTACAACGTCATTCCTTGCGGCAACCATTGGAATATTACAGAATGATCTAAAGAGGGTCCTAGCTTATTCAACTTGCAGTCAATTAGGCTATATGATCTTTGCTTGCGGCATCTCTAACTATTCGGTTAGCGTCTTTCACTTAATGAATCACGCGTTTTTCAAAGCATTACTATTCCTGAGTGTAGGTTCAGTGATTCATGCCACGTCGGATGAGCAAGATATGCGGAAGAGGGGCTTGCCTCCTGTTCCCTTTTACCTATGTCATGATGCTCATGGGTAG ATGGTAACAGCTGGCGTTTTCATGATAGCCAGGTGCTCCCCTTTATTTGAATACCCGCCTACGACTTTGATTGTTATTACTTCTACAGGAGCTACAACGTCATTCCTTGCGGCAACCATTGGAATATTACAGAATGATCTAAAGAGGGTCCTAGCTTATTCAACTTGCAGTCAATTAGGCTATATGATCTTTGCTTGCGGCATCTCTAACTATTCGGTTAGCGTCTTTCACTTAATGAATCACGCGTTTTTCAAAGCATTACTATTCCTGAGTGTAGGTTCAGTGATTCATGCCACGTCGGATGAGCAAGATATGCGGAAGAGGGGCTTGCCTCCTGTTCCCTTTTACCTATGTCATGATGCTCATGGGTAG MVTAGVFMIARCSPLFEYPPTTLIVITSTGATTSFLAATIGILQNDLKRVLAYSTCSQLGYMIFACGISNYSVSVFHLMNHAFFKALLFLSVGSVIHATSDEQDMRKRGLPPVPFYLCHDAHG Homology
BLAST of Csor.00g241240 vs. ExPASy Swiss-Prot
Match: P29388 (NADH-ubiquinone oxidoreductase chain 5 OS=Arabidopsis thaliana OX=3702 GN=ND5 PE=1 SV=3) HSP 1 Score: 195.7 bits (496), Expect = 3.1e-49 Identity = 100/109 (91.74%), Postives = 101/109 (92.66%), Query Frame = 0
BLAST of Csor.00g241240 vs. ExPASy Swiss-Prot
Match: P10330 (NADH-ubiquinone oxidoreductase chain 5 OS=Oenothera berteroana OX=3950 GN=ND5 PE=2 SV=2) HSP 1 Score: 193.4 bits (490), Expect = 1.6e-48 Identity = 99/109 (90.83%), Postives = 100/109 (91.74%), Query Frame = 0
BLAST of Csor.00g241240 vs. ExPASy Swiss-Prot
Match: Q37680 (NADH-ubiquinone oxidoreductase chain 5 OS=Triticum aestivum OX=4565 GN=ND5 PE=3 SV=1) HSP 1 Score: 193.4 bits (490), Expect = 1.6e-48 Identity = 99/109 (90.83%), Postives = 100/109 (91.74%), Query Frame = 0
BLAST of Csor.00g241240 vs. ExPASy Swiss-Prot
Match: P26849 (NADH-ubiquinone oxidoreductase chain 5 OS=Marchantia polymorpha OX=3197 GN=ND5 PE=3 SV=2) HSP 1 Score: 186.8 bits (473), Expect = 1.5e-46 Identity = 96/109 (88.07%), Postives = 97/109 (88.99%), Query Frame = 0
BLAST of Csor.00g241240 vs. ExPASy Swiss-Prot
Match: Q35099 (NADH-ubiquinone oxidoreductase chain 5 OS=Metridium senile OX=6116 GN=ND5 PE=3 SV=1) HSP 1 Score: 164.9 bits (416), Expect = 5.9e-40 Identity = 80/117 (68.38%), Postives = 98/117 (83.76%), Query Frame = 0
BLAST of Csor.00g241240 vs. NCBI nr
Match: KAG6601739.1 (NADH-ubiquinone oxidoreductase chain 5, partial [Cucurbita argyrosperma subsp. sororia]) HSP 1 Score: 248 bits (632), Expect = 9.48e-83 Identity = 123/123 (100.00%), Postives = 123/123 (100.00%), Query Frame = 0
BLAST of Csor.00g241240 vs. NCBI nr
Match: CCA95086.1 (NADH dehydrogenase subunit 5, partial [Laburnum anagyroides]) HSP 1 Score: 200 bits (509), Expect = 1.59e-63 Identity = 102/109 (93.58%), Postives = 103/109 (94.50%), Query Frame = 0
BLAST of Csor.00g241240 vs. NCBI nr
Match: PRQ15598.1 (putative NADH:ubiquinone reductase (H(+)-translocating) [Rosa chinensis]) HSP 1 Score: 200 bits (509), Expect = 1.37e-62 Identity = 102/109 (93.58%), Postives = 103/109 (94.50%), Query Frame = 0
BLAST of Csor.00g241240 vs. NCBI nr
Match: ADL63527.1 (NADH dehydrogenase subunit 5, partial [Anisoptera marginata]) HSP 1 Score: 202 bits (515), Expect = 1.78e-62 Identity = 103/109 (94.50%), Postives = 104/109 (95.41%), Query Frame = 0
BLAST of Csor.00g241240 vs. NCBI nr
Match: KYP45815.1 (NADH-ubiquinone oxidoreductase chain 5 [Cajanus cajan]) HSP 1 Score: 200 bits (509), Expect = 2.18e-62 Identity = 101/109 (92.66%), Postives = 103/109 (94.50%), Query Frame = 0
BLAST of Csor.00g241240 vs. ExPASy TrEMBL
Match: H1ZY33 (NADH dehydrogenase subunit 5 (Fragment) OS=Laburnum anagyroides OX=49828 GN=nad5 PE=4 SV=1) HSP 1 Score: 200 bits (509), Expect = 7.71e-64 Identity = 102/109 (93.58%), Postives = 103/109 (94.50%), Query Frame = 0
BLAST of Csor.00g241240 vs. ExPASy TrEMBL
Match: A0A2P6P0Z0 (Putative NADH:ubiquinone reductase (H(+)-translocating) OS=Rosa chinensis OX=74649 GN=RchiOBHm_MTg0498221 PE=4 SV=1) HSP 1 Score: 200 bits (509), Expect = 6.61e-63 Identity = 102/109 (93.58%), Postives = 103/109 (94.50%), Query Frame = 0
BLAST of Csor.00g241240 vs. ExPASy TrEMBL
Match: E5DL59 (NADH dehydrogenase subunit 5 (Fragment) OS=Anisoptera marginata OX=69458 GN=nad5 PE=4 SV=1) HSP 1 Score: 202 bits (515), Expect = 8.64e-63 Identity = 103/109 (94.50%), Postives = 104/109 (95.41%), Query Frame = 0
BLAST of Csor.00g241240 vs. ExPASy TrEMBL
Match: A0A151RTF0 (NADH-ubiquinone oxidoreductase chain 5 OS=Cajanus cajan OX=3821 GN=KK1_032633 PE=4 SV=1) HSP 1 Score: 200 bits (509), Expect = 1.06e-62 Identity = 101/109 (92.66%), Postives = 103/109 (94.50%), Query Frame = 0
BLAST of Csor.00g241240 vs. ExPASy TrEMBL
Match: E5DLJ3 (NADH dehydrogenase subunit 5 (Fragment) OS=Olinia emarginata OX=216176 GN=nad5 PE=4 SV=1) HSP 1 Score: 200 bits (508), Expect = 2.60e-62 Identity = 102/109 (93.58%), Postives = 103/109 (94.50%), Query Frame = 0
BLAST of Csor.00g241240 vs. TAIR 10
Match: ATMG00060.1 (NADH dehydrogenase subunit 5C ) HSP 1 Score: 201.1 bits (510), Expect = 5.3e-52 Identity = 102/109 (93.58%), Postives = 103/109 (94.50%), Query Frame = 0
BLAST of Csor.00g241240 vs. TAIR 10
Match: ATMG00513.1 (NADH dehydrogenase 5A ) HSP 1 Score: 201.1 bits (510), Expect = 5.3e-52 Identity = 102/109 (93.58%), Postives = 103/109 (94.50%), Query Frame = 0
BLAST of Csor.00g241240 vs. TAIR 10
Match: ATMG00665.1 (NADH dehydrogenase 5B ) HSP 1 Score: 201.1 bits (510), Expect = 5.3e-52 Identity = 102/109 (93.58%), Postives = 103/109 (94.50%), Query Frame = 0
BLAST of Csor.00g241240 vs. TAIR 10
Match: ATCG01010.1 (NADH-Ubiquinone oxidoreductase (complex I), chain 5 protein ) HSP 1 Score: 99.4 bits (246), Expect = 2.2e-21 Identity = 50/98 (51.02%), Postives = 69/98 (70.41%), Query Frame = 0
The following BLAST results are available for this feature:
InterPro
Analysis Name: InterPro Annotations of Silver-seed gourd (sororia) v1
Date Performed: 2021-10-25 Position : 0 Zoom : x 1
Relationships
The following mRNA feature(s) are a part of this gene:
GO Annotation
GO Assignments
This gene is annotated with the following GO terms.
|