
CaUC09G178360 (gene) Watermelon (USVL246-FR2) v1
Overview
Sequences
The following sequences are available for this feature:
Legend: exonCDSpolypeptide Hold the cursor over a type above to highlight its positions in the sequence below.ATGAGTTCGTACGTGGAGGTTGGTCCGGGACAAAACGAAGCCTTGCTCGAAGGTCCAAAAGATGTTGAACTTGGGCGGTGGGAACCGATCGAGCATATCGAAGATCCATACGTGCAAGAGATCGGAAGGTTTGCAGTAATGGAGCACAACAAGCAAACAGGGGCAAACCTAAAGTTCATCCATGTGATAAATGGTGAGAAACAAGTGGTGGCTGGAATAAATTATAGGCTTAGGATTGAAGCAAGGAATGAAATGAATTTGGTTTGGACTTATGAGGCTTTGGTGAATGATAGGCCATGGGAGAAGAAGTGGAAGCTCATATATTTTGTACCTCTCCTCAAGAACTGA ATGAGTTCGTACGTGGAGGTTGGTCCGGGACAAAACGAAGCCTTGCTCGAAGGTCCAAAAGATGTTGAACTTGGGCGGTGGGAACCGATCGAGCATATCGAAGATCCATACGTGCAAGAGATCGGAAGGTTTGCAGTAATGGAGCACAACAAGCAAACAGGGGCAAACCTAAAGTTCATCCATGTGATAAATGGTGAGAAACAAGTGGTGGCTGGAATAAATTATAGGCTTAGGATTGAAGCAAGGAATGAAATGAATTTGGTTTGGACTTATGAGGCTTTGGTGAATGATAGGCCATGGGAGAAGAAGTGGAAGCTCATATATTTTGTACCTCTCCTCAAGAACTGA ATGAGTTCGTACGTGGAGGTTGGTCCGGGACAAAACGAAGCCTTGCTCGAAGGTCCAAAAGATGTTGAACTTGGGCGGTGGGAACCGATCGAGCATATCGAAGATCCATACGTGCAAGAGATCGGAAGGTTTGCAGTAATGGAGCACAACAAGCAAACAGGGGCAAACCTAAAGTTCATCCATGTGATAAATGGTGAGAAACAAGTGGTGGCTGGAATAAATTATAGGCTTAGGATTGAAGCAAGGAATGAAATGAATTTGGTTTGGACTTATGAGGCTTTGGTGAATGATAGGCCATGGGAGAAGAAGTGGAAGCTCATATATTTTGTACCTCTCCTCAAGAACTGA MSSYVEVGPGQNEALLEGPKDVELGRWEPIEHIEDPYVQEIGRFAVMEHNKQTGANLKFIHVINGEKQVVAGINYRLRIEARNEMNLVWTYEALVNDRPWEKKWKLIYFVPLLKN Homology
BLAST of CaUC09G178360 vs. NCBI nr
Match: XP_038897049.1 (cysteine proteinase inhibitor 5-like [Benincasa hispida]) HSP 1 Score: 229.2 bits (583), Expect = 1.8e-56 Identity = 106/115 (92.17%), Postives = 113/115 (98.26%), Query Frame = 0
BLAST of CaUC09G178360 vs. NCBI nr
Match: XP_022936213.1 (cysteine proteinase inhibitor 1-like [Cucurbita moschata]) HSP 1 Score: 170.2 bits (430), Expect = 1.0e-38 Identity = 80/115 (69.57%), Postives = 95/115 (82.61%), Query Frame = 0
BLAST of CaUC09G178360 vs. NCBI nr
Match: KAG6592144.1 (Cysteine proteinase inhibitor 1, partial [Cucurbita argyrosperma subsp. sororia]) HSP 1 Score: 166.8 bits (421), Expect = 1.1e-37 Identity = 78/115 (67.83%), Postives = 95/115 (82.61%), Query Frame = 0
BLAST of CaUC09G178360 vs. NCBI nr
Match: XP_022975710.1 (cysteine proteinase inhibitor 1-like [Cucurbita maxima]) HSP 1 Score: 166.4 bits (420), Expect = 1.5e-37 Identity = 79/115 (68.70%), Postives = 94/115 (81.74%), Query Frame = 0
BLAST of CaUC09G178360 vs. NCBI nr
Match: KAG6592148.1 (Cysteine proteinase inhibitor 1, partial [Cucurbita argyrosperma subsp. sororia]) HSP 1 Score: 166.4 bits (420), Expect = 1.5e-37 Identity = 78/115 (67.83%), Postives = 94/115 (81.74%), Query Frame = 0
BLAST of CaUC09G178360 vs. ExPASy Swiss-Prot
Match: Q41916 (Cysteine proteinase inhibitor 5 OS=Arabidopsis thaliana OX=3702 GN=CYS5 PE=2 SV=2) HSP 1 Score: 84.0 bits (206), Expect = 1.2e-15 Identity = 41/88 (46.59%), Postives = 57/88 (64.77%), Query Frame = 0
BLAST of CaUC09G178360 vs. ExPASy Swiss-Prot
Match: P86472 (Cysteine proteinase inhibitor 1 OS=Actinidia chinensis var. chinensis OX=1590841 GN=CYT1 PE=1 SV=2) HSP 1 Score: 80.5 bits (197), Expect = 1.4e-14 Identity = 41/87 (47.13%), Postives = 56/87 (64.37%), Query Frame = 0
BLAST of CaUC09G178360 vs. ExPASy Swiss-Prot
Match: Q6TPK4 (Cysteine proteinase inhibitor 1 OS=Actinidia deliciosa OX=3627 PE=1 SV=1) HSP 1 Score: 79.0 bits (193), Expect = 4.0e-14 Identity = 41/87 (47.13%), Postives = 55/87 (63.22%), Query Frame = 0
BLAST of CaUC09G178360 vs. ExPASy Swiss-Prot
Match: Q10Q47 (Putative cysteine proteinase inhibitor 7 OS=Oryza sativa subsp. japonica OX=39947 GN=Os03g0210100 PE=3 SV=1) HSP 1 Score: 76.3 bits (186), Expect = 2.6e-13 Identity = 44/101 (43.56%), Postives = 63/101 (62.38%), Query Frame = 0
BLAST of CaUC09G178360 vs. ExPASy Swiss-Prot
Match: Q10Q46 (Cysteine proteinase inhibitor 6 OS=Oryza sativa subsp. japonica OX=39947 GN=Os03g0210200 PE=3 SV=1) HSP 1 Score: 72.8 bits (177), Expect = 2.9e-12 Identity = 37/85 (43.53%), Postives = 60/85 (70.59%), Query Frame = 0
BLAST of CaUC09G178360 vs. ExPASy TrEMBL
Match: A0A6J1FCN1 (cysteine proteinase inhibitor 1-like OS=Cucurbita moschata OX=3662 GN=LOC111442885 PE=4 SV=1) HSP 1 Score: 170.2 bits (430), Expect = 4.9e-39 Identity = 80/115 (69.57%), Postives = 95/115 (82.61%), Query Frame = 0
BLAST of CaUC09G178360 vs. ExPASy TrEMBL
Match: A0A6J1IHH5 (cysteine proteinase inhibitor 1-like OS=Cucurbita maxima OX=3661 GN=LOC111475753 PE=4 SV=1) HSP 1 Score: 166.4 bits (420), Expect = 7.1e-38 Identity = 79/115 (68.70%), Postives = 94/115 (81.74%), Query Frame = 0
BLAST of CaUC09G178360 vs. ExPASy TrEMBL
Match: A0A6J1IDU0 (cysteine proteinase inhibitor 8-like OS=Cucurbita maxima OX=3661 GN=LOC111475783 PE=4 SV=1) HSP 1 Score: 151.0 bits (380), Expect = 3.1e-33 Identity = 73/116 (62.93%), Postives = 91/116 (78.45%), Query Frame = 0
BLAST of CaUC09G178360 vs. ExPASy TrEMBL
Match: A0A6J1FCN5 (cysteine proteinase inhibitor 8-like OS=Cucurbita moschata OX=3662 GN=LOC111442890 PE=4 SV=1) HSP 1 Score: 151.0 bits (380), Expect = 3.1e-33 Identity = 73/116 (62.93%), Postives = 90/116 (77.59%), Query Frame = 0
BLAST of CaUC09G178360 vs. ExPASy TrEMBL
Match: A0A6J1IK23 (cysteine proteinase inhibitor A-like OS=Cucurbita maxima OX=3661 GN=LOC111475738 PE=4 SV=1) HSP 1 Score: 150.2 bits (378), Expect = 5.2e-33 Identity = 74/115 (64.35%), Postives = 87/115 (75.65%), Query Frame = 0
BLAST of CaUC09G178360 vs. TAIR 10
Match: AT5G47550.1 (Cystatin/monellin superfamily protein ) HSP 1 Score: 84.0 bits (206), Expect = 8.9e-17 Identity = 41/88 (46.59%), Postives = 57/88 (64.77%), Query Frame = 0
BLAST of CaUC09G178360 vs. TAIR 10
Match: AT4G16500.1 (Cystatin/monellin superfamily protein ) HSP 1 Score: 65.1 bits (157), Expect = 4.3e-11 Identity = 29/77 (37.66%), Postives = 49/77 (63.64%), Query Frame = 0
BLAST of CaUC09G178360 vs. TAIR 10
Match: AT2G40880.1 (cystatin A ) HSP 1 Score: 51.2 bits (121), Expect = 6.4e-07 Identity = 25/63 (39.68%), Postives = 38/63 (60.32%), Query Frame = 0
BLAST of CaUC09G178360 vs. TAIR 10
Match: AT3G12490.2 (cystatin B ) HSP 1 Score: 48.5 bits (114), Expect = 4.1e-06 Identity = 30/74 (40.54%), Postives = 41/74 (55.41%), Query Frame = 0
BLAST of CaUC09G178360 vs. TAIR 10
Match: AT3G12490.1 (cystatin B ) HSP 1 Score: 48.5 bits (114), Expect = 4.1e-06 Identity = 30/74 (40.54%), Postives = 41/74 (55.41%), Query Frame = 0
The following BLAST results are available for this feature:
InterPro
Analysis Name: InterPro Annotations of Watermelon (USVL246-FR2) v1
Date Performed: 2022-01-31 Position : 0 Zoom : x 1
Relationships
The following mRNA feature(s) are a part of this gene:
GO Annotation
GO Assignments
This gene is annotated with the following GO terms.
|