Cla97C10G188700 (gene) Watermelon (97103) v2.5
Overview
Sequences
The following sequences are available for this feature:
Legend: exonCDSpolypeptide Hold the cursor over a type above to highlight its positions in the sequence below.ATGGAGATCCCCACCAAAGTAGTGAAGTTCAGATTCCACATTGCAGTAACCCTAATCCTCTGTTTAACTCTCTTCTCCCTCATCCTTCTCGCTCCAAGATTCCTCTCGCTCCTCGCTTACTTTTGGCCTCTCTTCCTCTCCACCGCCGTCTTCCTCCTCGCCGTCCTCCTCTTCGCCAACACCTCCCTTCCGCCGCCTGATAAAGCCGCCGAAGGCCTCCTCAACTATGTCGCCGGCCACCACGACCACCACCACATCGACGCCTCTCTCAAATCCGATTAA ATGGAGATCCCCACCAAAGTAGTGAAGTTCAGATTCCACATTGCAGTAACCCTAATCCTCTGTTTAACTCTCTTCTCCCTCATCCTTCTCGCTCCAAGATTCCTCTCGCTCCTCGCTTACTTTTGGCCTCTCTTCCTCTCCACCGCCGTCTTCCTCCTCGCCGTCCTCCTCTTCGCCAACACCTCCCTTCCGCCGCCTGATAAAGCCGCCGAAGGCCTCCTCAACTATGTCGCCGGCCACCACGACCACCACCACATCGACGCCTCTCTCAAATCCGATTAA ATGGAGATCCCCACCAAAGTAGTGAAGTTCAGATTCCACATTGCAGTAACCCTAATCCTCTGTTTAACTCTCTTCTCCCTCATCCTTCTCGCTCCAAGATTCCTCTCGCTCCTCGCTTACTTTTGGCCTCTCTTCCTCTCCACCGCCGTCTTCCTCCTCGCCGTCCTCCTCTTCGCCAACACCTCCCTTCCGCCGCCTGATAAAGCCGCCGAAGGCCTCCTCAACTATGTCGCCGGCCACCACGACCACCACCACATCGACGCCTCTCTCAAATCCGATTAA MEIPTKVVKFRFHIAVTLILCLTLFSLILLAPRFLSLLAYFWPLFLSTAVFLLAVLLFANTSLPPPDKAAEGLLNYVAGHHDHHHIDASLKSD Homology
BLAST of Cla97C10G188700 vs. NCBI nr
Match: KGN56016.1 (hypothetical protein Csa_010324 [Cucumis sativus]) HSP 1 Score: 137.5 bits (345), Expect = 5.9e-29 Identity = 78/93 (83.87%), Postives = 83/93 (89.25%), Query Frame = 0
BLAST of Cla97C10G188700 vs. NCBI nr
Match: KAG7028299.1 (hypothetical protein SDJN02_09480, partial [Cucurbita argyrosperma subsp. argyrosperma]) HSP 1 Score: 131.7 bits (330), Expect = 3.2e-27 Identity = 72/93 (77.42%), Postives = 78/93 (83.87%), Query Frame = 0
BLAST of Cla97C10G188700 vs. NCBI nr
Match: KAG6596766.1 (hypothetical protein SDJN03_09946, partial [Cucurbita argyrosperma subsp. sororia]) HSP 1 Score: 130.6 bits (327), Expect = 7.2e-27 Identity = 71/93 (76.34%), Postives = 78/93 (83.87%), Query Frame = 0
BLAST of Cla97C10G188700 vs. NCBI nr
Match: KAG6577526.1 (hypothetical protein SDJN03_25100, partial [Cucurbita argyrosperma subsp. sororia] >KAG7015588.1 hypothetical protein SDJN02_23224, partial [Cucurbita argyrosperma subsp. argyrosperma]) HSP 1 Score: 128.3 bits (321), Expect = 3.6e-26 Identity = 69/84 (82.14%), Postives = 73/84 (86.90%), Query Frame = 0
BLAST of Cla97C10G188700 vs. NCBI nr
Match: PON94035.1 (hypothetical protein TorRG33x02_100740 [Trema orientale]) HSP 1 Score: 107.8 bits (268), Expect = 5.0e-20 Identity = 58/94 (61.70%), Postives = 73/94 (77.66%), Query Frame = 0
BLAST of Cla97C10G188700 vs. ExPASy TrEMBL
Match: A0A0A0L7E9 (Uncharacterized protein OS=Cucumis sativus OX=3659 GN=Csa_3G047770 PE=4 SV=1) HSP 1 Score: 137.5 bits (345), Expect = 2.8e-29 Identity = 78/93 (83.87%), Postives = 83/93 (89.25%), Query Frame = 0
BLAST of Cla97C10G188700 vs. ExPASy TrEMBL
Match: A0A2P5F8A8 (Uncharacterized protein OS=Trema orientale OX=63057 GN=TorRG33x02_100740 PE=4 SV=1) HSP 1 Score: 107.8 bits (268), Expect = 2.4e-20 Identity = 58/94 (61.70%), Postives = 73/94 (77.66%), Query Frame = 0
BLAST of Cla97C10G188700 vs. ExPASy TrEMBL
Match: A0A2P5AA24 (Uncharacterized protein OS=Parasponia andersonii OX=3476 GN=PanWU01x14_353270 PE=4 SV=1) HSP 1 Score: 104.0 bits (258), Expect = 3.5e-19 Identity = 55/96 (57.29%), Postives = 73/96 (76.04%), Query Frame = 0
BLAST of Cla97C10G188700 vs. ExPASy TrEMBL
Match: A0A371EZD3 (Uncharacterized protein (Fragment) OS=Mucuna pruriens OX=157652 GN=CR513_49244 PE=4 SV=1) HSP 1 Score: 102.8 bits (255), Expect = 7.7e-19 Identity = 63/99 (63.64%), Postives = 71/99 (71.72%), Query Frame = 0
BLAST of Cla97C10G188700 vs. ExPASy TrEMBL
Match: M5WI68 (Uncharacterized protein OS=Prunus persica OX=3760 GN=PRUPE_4G242100 PE=4 SV=1) HSP 1 Score: 102.4 bits (254), Expect = 1.0e-18 Identity = 51/83 (61.45%), Postives = 68/83 (81.93%), Query Frame = 0
BLAST of Cla97C10G188700 vs. TAIR 10
Match: AT4G16400.1 (unknown protein; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G13175.1); Has 30201 Blast hits to 17322 proteins in 780 species: Archae - 12; Bacteria - 1396; Metazoa - 17338; Fungi - 3422; Plants - 5037; Viruses - 0; Other Eukaryotes - 2996 (source: NCBI BLink). ) HSP 1 Score: 65.5 bits (158), Expect = 2.6e-11 Identity = 36/85 (42.35%), Postives = 53/85 (62.35%), Query Frame = 0
BLAST of Cla97C10G188700 vs. TAIR 10
Match: AT3G13175.1 (unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 18 plant structures; EXPRESSED DURING: 12 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G16400.1); Has 29 Blast hits to 29 proteins in 8 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 29; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). ) HSP 1 Score: 63.2 bits (152), Expect = 1.3e-10 Identity = 44/106 (41.51%), Postives = 59/106 (55.66%), Query Frame = 0
The following BLAST results are available for this feature:
InterPro
Analysis Name: InterPro Annotations of Watermelon (97103) v2.5
Date Performed: 2022-01-31
Relationships
The following mRNA feature(s) are a part of this gene:
GO Annotation
GO Assignments
This gene is annotated with the following GO terms.
|