MS021985 (gene) Bitter gourd (TR) v1
|
Overview
Sequences
The following sequences are available for this feature:
Legend: CDSpolypeptide Hold the cursor over a type above to highlight its positions in the sequence below.TTTTTTACGTTGTTTACTTTAGTACCTGGGGGGTTTCGGAAAAGACCTATATGGGGCACCTTTTGGGTGTGGGACTTTTTTACGTTGTTTACTTTAGTACCTGGGGGGTTTCGGAAAAGACCTATATGGGGCACCTTTTGGGTGTGGGAC TTTTTTACGTTGTTTACTTTAGTACCTGGGGGGTTTCGGAAAAGACCTATATGGGGCACCTTTTGGGTGTGGGAC FFTLFTLVPGGFRKRPIWGTFWVWD Homology
BLAST of MS021985 vs. NCBI nr
Match: YP_009045777.1 (cytochrome c biogenesis C [Batis maritima] >AIC83380.1 cytochrome c biogenesis C [Batis maritima]) HSP 1 Score: 55.8 bits (133), Expect = 6.0e-05 Identity = 22/25 (88.00%), Postives = 23/25 (92.00%), Query Frame = 0
BLAST of MS021985 vs. NCBI nr
Match: YP_009153945.1 (cytochrome c biogenesis C [Gossypium hirsutum] >YP_009153978.1 cytochrome c biogenesis C [Gossypium harknessii] >YP_009177642.1 cytochrome c biogenesis C [Gossypium barbadense] >YP_009250142.1 cytochrome c biogenesis C [Gossypium raimondii] >YP_009388341.1 cytochrome c biogenesis C [Gossypium arboreum] >YP_009388380.1 cytochrome c biogenesis C [Gossypium thurberi] >YP_009388416.1 cytochrome c biogenesis C [Gossypium davidsonii] >YP_009388452.1 cytochrome c biogenesis C [Gossypium trilobum] >YP_009412587.1 cytochrome c biogenesis C [Hibiscus cannabinus] >XP_012482190.1 PREDICTED: putative cytochrome c biosynthesis ccmC-like mitochondrial protein [Gossypium raimondii] >AFO69212.1 cytochrome c biogenesis C [Gossypium hirsutum] >AGA54182.1 cytochrome c biogenesis C [Gossypium hirsutum] >AGA54216.1 cytochrome c biogenesis C [Gossypium harknessii] >AKQ51126.1 cytochrome c biogenesis C [Gossypium barbadense] >AMT85339.1 cytochrome c biogenesis C [Gossypium arboreum]) HSP 1 Score: 55.8 bits (133), Expect = 6.0e-05 Identity = 22/25 (88.00%), Postives = 23/25 (92.00%), Query Frame = 0
BLAST of MS021985 vs. NCBI nr
Match: YP_006666113.1 (CcmC [Malus domestica] >YP_009994945.1 CcmC [Sorbus aucuparia] >YP_010047102.1 cytochrome c biogenesis C [Pyrus betulifolia] >QKV49057.1 CcmC [Malus domestica] >QNP09239.1 CcmC [Sorbus aucuparia] >QPJ79539.1 cytochrome c biogenesis C [Pyrus betulifolia] >CBX33373.1 ccmC [Malus domestica]) HSP 1 Score: 55.8 bits (133), Expect = 6.0e-05 Identity = 22/25 (88.00%), Postives = 23/25 (92.00%), Query Frame = 0
BLAST of MS021985 vs. NCBI nr
Match: QXE43746.1 (cytochrome c biogenesis C [Cedrus deodara]) HSP 1 Score: 55.8 bits (133), Expect = 6.0e-05 Identity = 22/25 (88.00%), Postives = 23/25 (92.00%), Query Frame = 0
BLAST of MS021985 vs. NCBI nr
Match: AHF22773.1 (cytochrome c biogenesis C, partial [Dasiphora fruticosa subsp. floribunda]) HSP 1 Score: 55.8 bits (133), Expect = 6.0e-05 Identity = 22/25 (88.00%), Postives = 23/25 (92.00%), Query Frame = 0
BLAST of MS021985 vs. ExPASy Swiss-Prot
Match: P92527 (Putative cytochrome c biosynthesis ccmC-like mitochondrial protein OS=Arabidopsis thaliana OX=3702 GN=CCMC PE=2 SV=4) HSP 1 Score: 52.8 bits (125), Expect = 6.7e-07 Identity = 21/25 (84.00%), Postives = 22/25 (88.00%), Query Frame = 0
BLAST of MS021985 vs. ExPASy Swiss-Prot
Match: P38453 (Putative cytochrome c biosynthesis ccmC-like mitochondrial protein OS=Marchantia polymorpha OX=3197 GN=CCMC PE=3 SV=1) HSP 1 Score: 49.3 bits (116), Expect = 7.4e-06 Identity = 19/24 (79.17%), Postives = 21/24 (87.50%), Query Frame = 0
BLAST of MS021985 vs. ExPASy TrEMBL
Match: E9KZM9 (Putative cytochrome c biosynthesis ccmC-like mitochondrial protein OS=Vigna radiata var. radiata OX=3916 GN=ccmC PE=3 SV=1) HSP 1 Score: 55.8 bits (133), Expect = 2.9e-05 Identity = 22/25 (88.00%), Postives = 23/25 (92.00%), Query Frame = 0
BLAST of MS021985 vs. ExPASy TrEMBL
Match: S4SKY5 (Putative cytochrome c biosynthesis ccmC-like mitochondrial protein OS=Gossypium hirsutum OX=3635 GN=ccmC PE=3 SV=1) HSP 1 Score: 55.8 bits (133), Expect = 2.9e-05 Identity = 22/25 (88.00%), Postives = 23/25 (92.00%), Query Frame = 0
BLAST of MS021985 vs. ExPASy TrEMBL
Match: A0A7H1CQT8 (Putative cytochrome c biosynthesis ccmC-like mitochondrial protein OS=Sapindus mukorossi OX=57655 GN=ccmC PE=3 SV=1) HSP 1 Score: 55.8 bits (133), Expect = 2.9e-05 Identity = 22/25 (88.00%), Postives = 23/25 (92.00%), Query Frame = 0
BLAST of MS021985 vs. ExPASy TrEMBL
Match: A0A224ASH1 (Putative cytochrome c biosynthesis ccmC-like mitochondrial protein OS=Brassica rapa subsp. nipposinica OX=333344 GN=ccmC PE=3 SV=1) HSP 1 Score: 55.8 bits (133), Expect = 2.9e-05 Identity = 22/25 (88.00%), Postives = 23/25 (92.00%), Query Frame = 0
BLAST of MS021985 vs. ExPASy TrEMBL
Match: A0A0D6CA01 (Putative cytochrome c biosynthesis ccmC-like mitochondrial protein OS=Brassica nigra OX=3710 GN=ccmC PE=3 SV=1) HSP 1 Score: 55.8 bits (133), Expect = 2.9e-05 Identity = 22/25 (88.00%), Postives = 23/25 (92.00%), Query Frame = 0
BLAST of MS021985 vs. TAIR 10
Match: AT2G07681.1 (Cytochrome C assembly protein ) HSP 1 Score: 55.8 bits (133), Expect = 5.6e-09 Identity = 22/25 (88.00%), Postives = 23/25 (92.00%), Query Frame = 0
BLAST of MS021985 vs. TAIR 10
Match: AT2G07771.2 (Cytochrome C assembly protein ) HSP 1 Score: 55.8 bits (133), Expect = 5.6e-09 Identity = 22/25 (88.00%), Postives = 23/25 (92.00%), Query Frame = 0
BLAST of MS021985 vs. TAIR 10
Match: ATMG00900.1 (cytochrome C biogenesis 256 ) HSP 1 Score: 55.8 bits (133), Expect = 5.6e-09 Identity = 22/25 (88.00%), Postives = 23/25 (92.00%), Query Frame = 0
The following BLAST results are available for this feature:
Relationships
The following mRNA feature(s) are a part of this gene:
|