MC08g2288 (gene) Bitter gourd (Dali-11) v1
|
Overview
Sequences
The following sequences are available for this feature:
Legend: CDSpolypeptide Hold the cursor over a type above to highlight its positions in the sequence below.GCGACGACCATCTTTTTGATTGGTACCGCAGTAGCCCTTTGGTTGGGTATTGGAGCAACATTACCGATTGATAAATCCCTAACTTTAGCGACGACCATCTTTTTGATTGGTACCGCAGTAGCCCTTTGGTTGGGTATTGGAGCAACATTACCGATTGATAAATCCCTAACTTTA GCGACGACCATCTTTTTGATTGGTACCGCAGTAGCCCTTTGGTTGGGTATTGGAGCAACATTACCGATTGATAAATCCCTAACTTTA ATTIFLIGTAVALWLGIGATLPIDKSLTL Homology
BLAST of MC08g2288 vs. ExPASy Swiss-Prot
Match: Q3V503 (Cytochrome b6-f complex subunit 4 OS=Acorus calamus OX=4465 GN=petD PE=3 SV=1) HSP 1 Score: 56.6 bits (135), Expect = 5.4e-08 Identity = 28/29 (96.55%), Postives = 29/29 (100.00%), Query Frame = 0
BLAST of MC08g2288 vs. ExPASy Swiss-Prot
Match: A1EA39 (Cytochrome b6-f complex subunit 4 OS=Agrostis stolonifera OX=63632 GN=petD PE=3 SV=1) HSP 1 Score: 56.6 bits (135), Expect = 5.4e-08 Identity = 28/29 (96.55%), Postives = 29/29 (100.00%), Query Frame = 0
BLAST of MC08g2288 vs. ExPASy Swiss-Prot
Match: Q7FNS2 (Cytochrome b6-f complex subunit 4 OS=Atropa belladonna OX=33113 GN=petD PE=3 SV=1) HSP 1 Score: 56.6 bits (135), Expect = 5.4e-08 Identity = 28/29 (96.55%), Postives = 29/29 (100.00%), Query Frame = 0
BLAST of MC08g2288 vs. ExPASy Swiss-Prot
Match: Q7YJU7 (Cytochrome b6-f complex subunit 4 OS=Calycanthus floridus var. glaucus OX=212734 GN=petD PE=3 SV=1) HSP 1 Score: 56.6 bits (135), Expect = 5.4e-08 Identity = 28/29 (96.55%), Postives = 29/29 (100.00%), Query Frame = 0
BLAST of MC08g2288 vs. ExPASy Swiss-Prot
Match: A0A366 (Cytochrome b6-f complex subunit 4 OS=Coffea arabica OX=13443 GN=petD PE=3 SV=1) HSP 1 Score: 56.6 bits (135), Expect = 5.4e-08 Identity = 28/29 (96.55%), Postives = 29/29 (100.00%), Query Frame = 0
BLAST of MC08g2288 vs. NCBI nr
Match: KAG4199365.1 (hypothetical protein ERO13_A05G142175v2 [Gossypium hirsutum]) HSP 1 Score: 55.8 bits (133), Expect = 3.70e-09 Identity = 28/29 (96.55%), Postives = 29/29 (100.00%), Query Frame = 0
BLAST of MC08g2288 vs. NCBI nr
Match: KAG4171735.1 (hypothetical protein ERO13_A12G228650v2 [Gossypium hirsutum] >KAG4183040.1 hypothetical protein ERO13_A09G083720v2 [Gossypium hirsutum] >PRQ15683.1 putative cytochrome b/b6 [Rosa chinensis] >TYJ17990.1 hypothetical protein E1A91_A09G091200v1 [Gossypium mustelinum]) HSP 1 Score: 55.8 bits (133), Expect = 3.70e-09 Identity = 28/29 (96.55%), Postives = 29/29 (100.00%), Query Frame = 0
BLAST of MC08g2288 vs. NCBI nr
Match: KAB2065413.1 (hypothetical protein ES319_A09G087300v1 [Gossypium barbadense]) HSP 1 Score: 55.8 bits (133), Expect = 3.70e-09 Identity = 28/29 (96.55%), Postives = 29/29 (100.00%), Query Frame = 0
BLAST of MC08g2288 vs. NCBI nr
Match: TYI27064.1 (hypothetical protein ES332_A05G153400v1 [Gossypium tomentosum]) HSP 1 Score: 55.8 bits (133), Expect = 3.70e-09 Identity = 28/29 (96.55%), Postives = 29/29 (100.00%), Query Frame = 0
BLAST of MC08g2288 vs. NCBI nr
Match: KAF5819218.1 (putative cytochrome b/b6 domain superfamily [Helianthus annuus]) HSP 1 Score: 55.8 bits (133), Expect = 3.70e-09 Identity = 28/29 (96.55%), Postives = 29/29 (100.00%), Query Frame = 0
BLAST of MC08g2288 vs. ExPASy TrEMBL
Match: A0A5D2QIP0 (Uncharacterized protein OS=Gossypium tomentosum OX=34277 GN=ES332_A05G153400v1 PE=4 SV=1) HSP 1 Score: 55.8 bits (133), Expect = 1.79e-09 Identity = 28/29 (96.55%), Postives = 29/29 (100.00%), Query Frame = 0
BLAST of MC08g2288 vs. ExPASy TrEMBL
Match: A0A2P6P179 (Putative cytochrome b/b6 OS=Rosa chinensis OX=74649 GN=RchiOBHm_CPg0501911 PE=4 SV=1) HSP 1 Score: 55.8 bits (133), Expect = 1.79e-09 Identity = 28/29 (96.55%), Postives = 29/29 (100.00%), Query Frame = 0
BLAST of MC08g2288 vs. ExPASy TrEMBL
Match: A0A5J5UDD5 (Uncharacterized protein OS=Gossypium barbadense OX=3634 GN=ES319_A09G087300v1 PE=4 SV=1) HSP 1 Score: 55.8 bits (133), Expect = 1.79e-09 Identity = 28/29 (96.55%), Postives = 29/29 (100.00%), Query Frame = 0
BLAST of MC08g2288 vs. ExPASy TrEMBL
Match: A0A0A9SVP6 (RpoA OS=Arundo donax OX=35708 PE=4 SV=1) HSP 1 Score: 55.8 bits (133), Expect = 1.79e-09 Identity = 28/29 (96.55%), Postives = 29/29 (100.00%), Query Frame = 0
BLAST of MC08g2288 vs. ExPASy TrEMBL
Match: A0A251VCE9 (Putative cytochrome b/b6 OS=Helianthus annuus OX=4232 GN=HannXRQ_Chr02g0032961 PE=4 SV=1) HSP 1 Score: 55.8 bits (133), Expect = 1.79e-09 Identity = 28/29 (96.55%), Postives = 29/29 (100.00%), Query Frame = 0
BLAST of MC08g2288 vs. TAIR 10
Match: ATCG00730.1 (photosynthetic electron transfer D ) HSP 1 Score: 55.1 bits (131), Expect = 1.1e-08 Identity = 27/29 (93.10%), Postives = 28/29 (96.55%), Query Frame = 0
The following BLAST results are available for this feature:
Relationships
The following mRNA feature(s) are a part of this gene:
|