MC11g0112.1 (mRNA) Bitter gourd (Dali-11) v1

Overview


Name	MC11g0112.1
Type	mRNA
Organism	Momordica charantia cv. Dali-11 (Bitter gourd (Dali-11) v1)
Description	Unknown protein
Location	MC11: 791311 .. 791394 (+)
Sequence length	84
RNA-Seq Expression	MC11g0112.1
Synteny	MC11g0112.1

Sequences

The following sequences are available for this feature:

Legend: CDSpolypeptide

Hold the cursor over a type above to highlight its positions in the sequence below.

CCACAAGAAAACAGTATCCAAATTCCAAACGATAAAGTAAAATCCTCAAACATCATCAGTCTAAAACCAGCAAGACCAAGAAAA

CCACAAGAAAACAGTATCCAAATTCCAAACGATAAAGTAAAATCCTCAAACATCATCAGTCTAAAACCAGCAAGACCAAGAAAA

CCACAAGAAAACAGTATCCAAATTCCAAACGATAAAGTAAAATCCTCAAACATCATCAGTCTAAAACCAGCAAGACCAAGAAAA

PQENSIQIPNDKVKSSNIISLKPARPRK

Homology

The following BLAST results are available for this feature:


Match Name	E-value	Identity	Description


Match Name	E-value	Identity	Description


Match Name	E-value	Identity	Description


Match Name	E-value	Identity	Description

InterPro

Analysis Name: InterPro Annotations of Bitter gourd (Dali-11) v1
Date Performed: 2021-10-25


IPR Term	IPR Description	Source	Source Term	Source Description	Alignment
None	No IPR available	MOBIDB_LITE	mobidb-lite	disorder_prediction	coord: 1..28
None	No IPR available	MOBIDB_LITE	mobidb-lite	disorder_prediction	coord: 1..17

Relationships

This mRNA is a part of the following gene feature(s):


Feature Name	Unique Name	Type
MC11g0112	MC11g0112	gene

The following CDS feature(s) are a part of this mRNA:


Feature Name	Unique Name	Type
MC11g0112.1-cds	MC11g0112.1-cds-MC11:791311..791394	CDS

The following polypeptide feature(s) derives from this mRNA:


Feature Name	Unique Name	Type
MC11g0112.1	MC11g0112.1-protein	polypeptide