Sequences
The following sequences are available for this feature:
Gene sequence (with intron) Legend: CDSpolypeptide Hold the cursor over a type above to highlight its positions in the sequence below. GCTATTCTTTCAGAATTGTGGTTCGTGAGAAATAAAAGGATTTTT mRNA sequence GCTATTCTTTCAGAATTGTGGTTCGTGAGAAATAAAAGGATTTTT Coding sequence (CDS) GCTATTCTTTCAGAATTGTGGTTCGTGAGAAATAAAAGGATTTTT Protein sequence
Homology
The following BLAST results are available for this feature:
| Match Name | E-value | Identity | Description | |
|---|
| Match Name | E-value | Identity | Description | |
|---|
| Match Name | E-value | Identity | Description | |
|---|
| Match Name | E-value | Identity | Description | |
|---|
Relationships
This mRNA is a part of the following gene feature(s):
| Feature Name | Unique Name | Type |
|---|
| MC08g2068 | MC08g2068 | gene |
The following CDS feature(s) are a part of this mRNA:
| Feature Name | Unique Name | Type |
|---|
| MC08g2068.1-cds | MC08g2068.1-cds-MC08:29362711..29362755 | CDS |
The following polypeptide feature(s) derives from this mRNA:
| Feature Name | Unique Name | Type |
|---|
| MC08g2068.1 | MC08g2068.1-protein | polypeptide |
|
