Spg028613 (gene) Sponge gourd (cylindrica) v1
Overview
Sequences
The following sequences are available for this feature:
Legend: CDSpolypeptide Hold the cursor over a type above to highlight its positions in the sequence below.ATGGCGTTGGAATGGGTCGTTCTTGGCTACGCCGCTGCCGCCGAGGCAATCATGGTCCTCCTCCTCACGATCCCAGGCCTCGATGGCCTCCGCAAGGGCCTAATCGCCGTCACTCGCAATCTCCTCAAGCCCTTCCTCTCCGTCGTTCCCTTCTGCCTCTTCTTGCTCATGGACATCTATTGGAAATACGAGACTCGCCCCAGTTGCGAATCGGACTCCTGTACCCCTTCTGAGTACCTTCGCCACCAGAAATCGATCATGAAGAGCCAGCGCAACGCGCTCTTGATCGCTGCCGCGCTTGTGTTCTACTGGCTGTTGTACTCGGTGACCCATTTGGTTCTGAAGGTTGAGCAATTGAACCAGCGTGTTGAGAGGTTGAAGAATCGGGATTGA ATGGCGTTGGAATGGGTCGTTCTTGGCTACGCCGCTGCCGCCGAGGCAATCATGGTCCTCCTCCTCACGATCCCAGGCCTCGATGGCCTCCGCAAGGGCCTAATCGCCGTCACTCGCAATCTCCTCAAGCCCTTCCTCTCCGTCGTTCCCTTCTGCCTCTTCTTGCTCATGGACATCTATTGGAAATACGAGACTCGCCCCAGTTGCGAATCGGACTCCTGTACCCCTTCTGAGTACCTTCGCCACCAGAAATCGATCATGAAGAGCCAGCGCAACGCGCTCTTGATCGCTGCCGCGCTTGTGTTCTACTGGCTGTTGTACTCGGTGACCCATTTGGTTCTGAAGGTTGAGCAATTGAACCAGCGTGTTGAGAGGTTGAAGAATCGGGATTGA ATGGCGTTGGAATGGGTCGTTCTTGGCTACGCCGCTGCCGCCGAGGCAATCATGGTCCTCCTCCTCACGATCCCAGGCCTCGATGGCCTCCGCAAGGGCCTAATCGCCGTCACTCGCAATCTCCTCAAGCCCTTCCTCTCCGTCGTTCCCTTCTGCCTCTTCTTGCTCATGGACATCTATTGGAAATACGAGACTCGCCCCAGTTGCGAATCGGACTCCTGTACCCCTTCTGAGTACCTTCGCCACCAGAAATCGATCATGAAGAGCCAGCGCAACGCGCTCTTGATCGCTGCCGCGCTTGTGTTCTACTGGCTGTTGTACTCGGTGACCCATTTGGTTCTGAAGGTTGAGCAATTGAACCAGCGTGTTGAGAGGTTGAAGAATCGGGATTGA MALEWVVLGYAAAAEAIMVLLLTIPGLDGLRKGLIAVTRNLLKPFLSVVPFCLFLLMDIYWKYETRPSCESDSCTPSEYLRHQKSIMKSQRNALLIAAALVFYWLLYSVTHLVLKVEQLNQRVERLKNRD Homology
BLAST of Spg028613 vs. NCBI nr
Match: XP_022153951.1 (uncharacterized protein LOC111021338 [Momordica charantia]) HSP 1 Score: 249.6 bits (636), Expect = 1.5e-62 Identity = 128/130 (98.46%), Postives = 130/130 (100.00%), Query Frame = 0
BLAST of Spg028613 vs. NCBI nr
Match: XP_022942023.1 (uncharacterized protein LOC111447211 [Cucurbita moschata] >XP_022975389.1 uncharacterized protein LOC111474653 [Cucurbita maxima] >XP_023548406.1 uncharacterized protein LOC111807049 [Cucurbita pepo subsp. pepo] >XP_038891765.1 uncharacterized protein LOC120081154 [Benincasa hispida] >KAG6600838.1 hypothetical protein SDJN03_06071, partial [Cucurbita argyrosperma subsp. sororia] >KAG7031473.1 hypothetical protein SDJN02_05513, partial [Cucurbita argyrosperma subsp. argyrosperma]) HSP 1 Score: 249.2 bits (635), Expect = 1.9e-62 Identity = 127/130 (97.69%), Postives = 130/130 (100.00%), Query Frame = 0
BLAST of Spg028613 vs. NCBI nr
Match: KAA0040998.1 (Integral to membrane, endoplasmic reticulum [Cucumis melo var. makuwa] >TYK20348.1 Integral to membrane, endoplasmic reticulum [Cucumis melo var. makuwa]) HSP 1 Score: 248.4 bits (633), Expect = 3.3e-62 Identity = 126/130 (96.92%), Postives = 130/130 (100.00%), Query Frame = 0
BLAST of Spg028613 vs. NCBI nr
Match: XP_004142369.2 (uncharacterized protein LOC101213354 [Cucumis sativus]) HSP 1 Score: 248.1 bits (632), Expect = 4.3e-62 Identity = 125/130 (96.15%), Postives = 130/130 (100.00%), Query Frame = 0
BLAST of Spg028613 vs. NCBI nr
Match: XP_028952518.1 (uncharacterized protein LOC114822347 [Malus domestica] >RXH70334.1 hypothetical protein DVH24_007590 [Malus domestica]) HSP 1 Score: 244.6 bits (623), Expect = 4.8e-61 Identity = 122/130 (93.85%), Postives = 128/130 (98.46%), Query Frame = 0
BLAST of Spg028613 vs. ExPASy TrEMBL
Match: A0A6J1DM88 (Endoplasmic reticulum transmembrane protein OS=Momordica charantia OX=3673 GN=LOC111021338 PE=3 SV=1) HSP 1 Score: 249.6 bits (636), Expect = 7.2e-63 Identity = 128/130 (98.46%), Postives = 130/130 (100.00%), Query Frame = 0
BLAST of Spg028613 vs. ExPASy TrEMBL
Match: A0A6J1IKB0 (Endoplasmic reticulum transmembrane protein OS=Cucurbita maxima OX=3661 GN=LOC111474653 PE=3 SV=1) HSP 1 Score: 249.2 bits (635), Expect = 9.4e-63 Identity = 127/130 (97.69%), Postives = 130/130 (100.00%), Query Frame = 0
BLAST of Spg028613 vs. ExPASy TrEMBL
Match: A0A6J1FTP8 (Endoplasmic reticulum transmembrane protein OS=Cucurbita moschata OX=3662 GN=LOC111447211 PE=3 SV=1) HSP 1 Score: 249.2 bits (635), Expect = 9.4e-63 Identity = 127/130 (97.69%), Postives = 130/130 (100.00%), Query Frame = 0
BLAST of Spg028613 vs. ExPASy TrEMBL
Match: A0A5A7TDF8 (Endoplasmic reticulum transmembrane protein OS=Cucumis melo var. makuwa OX=1194695 GN=E5676_scaffold228G00440 PE=3 SV=1) HSP 1 Score: 248.4 bits (633), Expect = 1.6e-62 Identity = 126/130 (96.92%), Postives = 130/130 (100.00%), Query Frame = 0
BLAST of Spg028613 vs. ExPASy TrEMBL
Match: A0A0A0KTU7 (Endoplasmic reticulum transmembrane protein OS=Cucumis sativus OX=3659 GN=Csa_5G628640 PE=3 SV=1) HSP 1 Score: 248.1 bits (632), Expect = 2.1e-62 Identity = 125/130 (96.15%), Postives = 130/130 (100.00%), Query Frame = 0
BLAST of Spg028613 vs. TAIR 10
Match: AT5G17190.1 (FUNCTIONS IN: molecular_function unknown; INVOLVED IN: intracellular protein transport; LOCATED IN: endomembrane system, integral to membrane, endoplasmic reticulum; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: B-cell receptor-associated 31-like (InterPro:IPR008417); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G03160.1); Has 1807 Blast hits to 1807 proteins in 277 species: Archae - 0; Bacteria - 0; Metazoa - 736; Fungi - 347; Plants - 385; Viruses - 0; Other Eukaryotes - 339 (source: NCBI BLink). ) HSP 1 Score: 233.8 bits (595), Expect = 7.8e-62 Identity = 114/130 (87.69%), Postives = 128/130 (98.46%), Query Frame = 0
BLAST of Spg028613 vs. TAIR 10
Match: AT3G03160.1 (FUNCTIONS IN: molecular_function unknown; INVOLVED IN: intracellular protein transport; LOCATED IN: endomembrane system, integral to membrane, endoplasmic reticulum; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: B-cell receptor-associated 31-like (InterPro:IPR008417); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G17190.1); Has 102 Blast hits to 102 proteins in 17 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 102; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). ) HSP 1 Score: 231.5 bits (589), Expect = 3.9e-61 Identity = 113/130 (86.92%), Postives = 127/130 (97.69%), Query Frame = 0
BLAST of Spg028613 vs. TAIR 10
Match: AT1G48440.1 (B-cell receptor-associated 31-like ) HSP 1 Score: 99.8 bits (247), Expect = 1.8e-21 Identity = 52/127 (40.94%), Postives = 80/127 (62.99%), Query Frame = 0
BLAST of Spg028613 vs. TAIR 10
Match: AT3G17780.1 (FUNCTIONS IN: molecular_function unknown; INVOLVED IN: intracellular protein transport; LOCATED IN: endomembrane system, integral to membrane, endoplasmic reticulum; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: B-cell receptor-associated 31-like (InterPro:IPR008417); BEST Arabidopsis thaliana protein match is: B-cell receptor-associated 31-like (TAIR:AT1G48440.1); Has 102 Blast hits to 102 proteins in 17 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 102; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). ) HSP 1 Score: 99.4 bits (246), Expect = 2.3e-21 Identity = 51/128 (39.84%), Postives = 81/128 (63.28%), Query Frame = 0
The following BLAST results are available for this feature:
InterPro
Analysis Name: InterPro Annotations of Sponge gourd (cylindrica) v1
Date Performed: 2022-08-01
Relationships
The following mRNA feature(s) are a part of this gene:
GO Annotation
GO Assignments
This gene is annotated with the following GO terms.
|