MS021949 (gene) Bitter gourd (TR) v1
Overview
Sequences
The following sequences are available for this feature:
Legend: CDSpolypeptide Hold the cursor over a type above to highlight its positions in the sequence below.CTTCTCTATGGTTCTAGTTGTTGCTTCATCGAATTTGCTTGTTCACGATTTGACTTTGATCGTTATAGACCAATACCAAGATCTAGTCCTAGACAGACATGCTTAATT CTTCTCTATGGTTCTAGTTGTTGCTTCATCGAATTTGCTTGTTCACGATTTGACTTTGATCGTTATAGACCAATACCAAGATCTAGTCCTAGACAGACATGCTTAATT CTTCTCTATGGTTCTAGTTGTTGCTTCATCGAATTTGCTTGTTCACGATTTGACTTTGATCGTTATAGACCAATACCAAGATCTAGTCCTAGACAGACATGCTTAATT LLYGSSCCFIEFACSRFDFDRYRPIPRSSPRQTCLI Homology
BLAST of MS021949 vs. NCBI nr
Match: YP_009258725.1 (27 kDa subunit of NADH-ubiquinone oxidoreductase [Cylindrocystis brebissonii] >ANI25847.1 27 kDa subunit of NADH-ubiquinone oxidoreductase [Cylindrocystis brebissonii]) HSP 1 Score: 62.8 bits (151), Expect = 7.1e-07 Identity = 30/39 (76.92%), Postives = 32/39 (82.05%), Query Frame = 0
BLAST of MS021949 vs. NCBI nr
Match: QKQ14607.1 (27 kDa subunit of NADH-ubiquinone [Zygnema circumcarinatum]) HSP 1 Score: 62.8 bits (151), Expect = 7.1e-07 Identity = 30/39 (76.92%), Postives = 32/39 (82.05%), Query Frame = 0
BLAST of MS021949 vs. NCBI nr
Match: YP_009258368.1 (27 kDa subunit of NADH-ubiquinone oxidoreductase [Spirogyra maxima] >ANI25277.1 27 kDa subunit of NADH-ubiquinone oxidoreductase [Spirogyra maxima]) HSP 1 Score: 62.8 bits (151), Expect = 7.1e-07 Identity = 30/39 (76.92%), Postives = 32/39 (82.05%), Query Frame = 0
BLAST of MS021949 vs. NCBI nr
Match: KAF3772306.1 (NAD(P)H-quinone oxidoreductase subunit K [Nymphaea thermarum]) HSP 1 Score: 61.6 bits (148), Expect = 1.6e-06 Identity = 30/39 (76.92%), Postives = 32/39 (82.05%), Query Frame = 0
BLAST of MS021949 vs. NCBI nr
Match: TYI05631.1 (hypothetical protein ES332_A10G102700v1 [Gossypium tomentosum]) HSP 1 Score: 61.6 bits (148), Expect = 1.6e-06 Identity = 30/39 (76.92%), Postives = 32/39 (82.05%), Query Frame = 0
BLAST of MS021949 vs. ExPASy Swiss-Prot
Match: Q9TKY0 (NAD(P)H-quinone oxidoreductase subunit K, chloroplastic OS=Nephroselmis olivacea OX=31312 GN=ndhK PE=3 SV=1) HSP 1 Score: 61.2 bits (147), Expect = 2.7e-09 Identity = 29/39 (74.36%), Postives = 32/39 (82.05%), Query Frame = 0
BLAST of MS021949 vs. ExPASy Swiss-Prot
Match: Q8M9X9 (NAD(P)H-quinone oxidoreductase subunit K, chloroplastic OS=Chaetosphaeridium globosum OX=96477 GN=ndhK PE=3 SV=1) HSP 1 Score: 59.3 bits (142), Expect = 1.0e-08 Identity = 29/39 (74.36%), Postives = 31/39 (79.49%), Query Frame = 0
BLAST of MS021949 vs. ExPASy Swiss-Prot
Match: A9L9A0 (NAD(P)H-quinone oxidoreductase subunit K, chloroplastic OS=Lemna minor OX=4472 GN=ndhK PE=3 SV=2) HSP 1 Score: 59.3 bits (142), Expect = 1.0e-08 Identity = 29/39 (74.36%), Postives = 31/39 (79.49%), Query Frame = 0
BLAST of MS021949 vs. ExPASy Swiss-Prot
Match: Q9MUR0 (NAD(P)H-quinone oxidoreductase subunit K, chloroplastic OS=Mesostigma viride OX=41882 GN=ndhK PE=3 SV=1) HSP 1 Score: 59.3 bits (142), Expect = 1.0e-08 Identity = 28/39 (71.79%), Postives = 31/39 (79.49%), Query Frame = 0
BLAST of MS021949 vs. ExPASy Swiss-Prot
Match: Q2MII3 (NAD(P)H-quinone oxidoreductase subunit K, chloroplastic OS=Solanum bulbocastanum OX=147425 GN=ndhK PE=3 SV=2) HSP 1 Score: 59.3 bits (142), Expect = 1.0e-08 Identity = 29/39 (74.36%), Postives = 32/39 (82.05%), Query Frame = 0
BLAST of MS021949 vs. ExPASy TrEMBL
Match: A0A191T4G1 (NAD(P)H-quinone oxidoreductase subunit K, chloroplastic OS=Spirogyra maxima OX=3180 GN=ndhK PE=3 SV=1) HSP 1 Score: 62.8 bits (151), Expect = 3.4e-07 Identity = 30/39 (76.92%), Postives = 32/39 (82.05%), Query Frame = 0
BLAST of MS021949 vs. ExPASy TrEMBL
Match: A0A191T645 (NAD(P)H-quinone oxidoreductase subunit K, chloroplastic OS=Cylindrocystis brebissonii OX=102167 GN=ndhK PE=3 SV=1) HSP 1 Score: 62.8 bits (151), Expect = 3.4e-07 Identity = 30/39 (76.92%), Postives = 32/39 (82.05%), Query Frame = 0
BLAST of MS021949 vs. ExPASy TrEMBL
Match: A0A6N0GXA0 (NADH-quinone oxidoreductase subunit B OS=Zygnema circumcarinatum OX=35869 GN=ndhK PE=3 SV=1) HSP 1 Score: 62.8 bits (151), Expect = 3.4e-07 Identity = 30/39 (76.92%), Postives = 32/39 (82.05%), Query Frame = 0
BLAST of MS021949 vs. ExPASy TrEMBL
Match: A0A5D2NN84 (Oxidored_q6 domain-containing protein OS=Gossypium tomentosum OX=34277 GN=ES332_A10G102700v1 PE=3 SV=1) HSP 1 Score: 61.6 bits (148), Expect = 7.7e-07 Identity = 30/39 (76.92%), Postives = 32/39 (82.05%), Query Frame = 0
BLAST of MS021949 vs. ExPASy TrEMBL
Match: A0A088CKB8 (NAD(P)H-quinone oxidoreductase subunit K, chloroplastic OS=Nephroselmis astigmatica OX=259378 GN=ndhK PE=3 SV=1) HSP 1 Score: 61.2 bits (147), Expect = 1.0e-06 Identity = 29/39 (74.36%), Postives = 32/39 (82.05%), Query Frame = 0
BLAST of MS021949 vs. TAIR 10
Match: ATCG00430.1 (photosystem II reaction center protein G ) HSP 1 Score: 58.9 bits (141), Expect = 9.6e-10 Identity = 29/39 (74.36%), Postives = 31/39 (79.49%), Query Frame = 0
The following BLAST results are available for this feature:
Relationships
The following mRNA feature(s) are a part of this gene:
|