![](http://cucurbitgenomics.org/sites/default/files/styles/slideshow/public/carousel/101322_web.jpg?itok=EG-G51x6)
MS017884 (gene) Bitter gourd (TR) v1
Overview
Sequences
The following sequences are available for this feature:
Legend: CDSpolypeptide Hold the cursor over a type above to highlight its positions in the sequence below.ATGACTGCAATTTTAGAGAGACGCGAAAGCGAAAGCCTATGGGGTAATTTCTGTAACTGGATAACCAGCACTGAAAACTGTCTCCTGGTC ATGACTGCAATTTTAGAGAGACGCGAAAGCGAAAGCCTATGGGGTAATTTCTGTAACTGGATAACCAGCACTGAAAACTGTCTCCTGGTC ATGACTGCAATTTTAGAGAGACGCGAAAGCGAAAGCCTATGGGGTAATTTCTGTAACTGGATAACCAGCACTGAAAACTGTCTCCTGGTC MTAILERRESESLWGNFCNWITSTENCLLV Homology
BLAST of MS017884 vs. NCBI nr
Match: TYG76239.1 (hypothetical protein ES288_D03G098800v1 [Gossypium darwinii]) HSP 1 Score: 63.9 bits (154), Expect = 2.7e-07 Identity = 27/30 (90.00%), Postives = 28/30 (93.33%), Query Frame = 0
BLAST of MS017884 vs. NCBI nr
Match: QHO20335.1 (Photosystem II protein [Arachis hypogaea]) HSP 1 Score: 62.4 bits (150), Expect = 7.7e-07 Identity = 26/30 (86.67%), Postives = 27/30 (90.00%), Query Frame = 0
BLAST of MS017884 vs. NCBI nr
Match: XP_037442017.1 (photosystem II protein D1-like [Triticum dicoccoides]) HSP 1 Score: 61.6 bits (148), Expect = 1.3e-06 Identity = 26/30 (86.67%), Postives = 27/30 (90.00%), Query Frame = 0
BLAST of MS017884 vs. NCBI nr
Match: ALI90478.1 (PsbA, partial [Discophora guianensis]) HSP 1 Score: 59.7 bits (143), Expect = 5.0e-06 Identity = 27/30 (90.00%), Postives = 27/30 (90.00%), Query Frame = 0
BLAST of MS017884 vs. NCBI nr
Match: PHT40440.1 (Photosystem II protein D1 [Capsicum baccatum]) HSP 1 Score: 59.7 bits (143), Expect = 5.0e-06 Identity = 26/30 (86.67%), Postives = 28/30 (93.33%), Query Frame = 0
BLAST of MS017884 vs. ExPASy Swiss-Prot
Match: A4QJ96 (Photosystem II protein D1 OS=Aethionema cordifolium OX=434059 GN=psbA PE=3 SV=1) HSP 1 Score: 59.3 bits (142), Expect = 8.6e-09 Identity = 26/30 (86.67%), Postives = 27/30 (90.00%), Query Frame = 0
BLAST of MS017884 vs. ExPASy Swiss-Prot
Match: A4QJI0 (Photosystem II protein D1 OS=Aethionema grandiflorum OX=72657 GN=psbA PE=3 SV=1) HSP 1 Score: 59.3 bits (142), Expect = 8.6e-09 Identity = 26/30 (86.67%), Postives = 27/30 (90.00%), Query Frame = 0
BLAST of MS017884 vs. ExPASy Swiss-Prot
Match: P02956 (Photosystem II protein D1 OS=Amaranthus hybridus OX=3565 GN=psbA PE=3 SV=1) HSP 1 Score: 59.3 bits (142), Expect = 8.6e-09 Identity = 26/30 (86.67%), Postives = 27/30 (90.00%), Query Frame = 0
BLAST of MS017884 vs. ExPASy Swiss-Prot
Match: A4QJZ9 (Photosystem II protein D1 OS=Arabis hirsuta OX=78191 GN=psbA PE=3 SV=1) HSP 1 Score: 59.3 bits (142), Expect = 8.6e-09 Identity = 26/30 (86.67%), Postives = 27/30 (90.00%), Query Frame = 0
BLAST of MS017884 vs. ExPASy Swiss-Prot
Match: P83755 (Photosystem II protein D1 OS=Arabidopsis thaliana OX=3702 GN=psbA PE=1 SV=2) HSP 1 Score: 59.3 bits (142), Expect = 8.6e-09 Identity = 26/30 (86.67%), Postives = 27/30 (90.00%), Query Frame = 0
BLAST of MS017884 vs. ExPASy TrEMBL
Match: A0A5D2D3N9 (Photosystem II protein D1 OS=Gossypium darwinii OX=34276 GN=ES288_D03G098800v1 PE=3 SV=1) HSP 1 Score: 63.9 bits (154), Expect = 1.3e-07 Identity = 27/30 (90.00%), Postives = 28/30 (93.33%), Query Frame = 0
BLAST of MS017884 vs. ExPASy TrEMBL
Match: A0A0S0ZJ74 (Photosystem II protein D1 (Fragment) OS=Discophora guianensis OX=159368 GN=psbA PE=3 SV=1) HSP 1 Score: 59.7 bits (143), Expect = 2.4e-06 Identity = 27/30 (90.00%), Postives = 27/30 (90.00%), Query Frame = 0
BLAST of MS017884 vs. ExPASy TrEMBL
Match: A0A2G2W5D4 (Photosystem II protein D1 OS=Capsicum baccatum OX=33114 GN=CQW23_19294 PE=3 SV=1) HSP 1 Score: 59.7 bits (143), Expect = 2.4e-06 Identity = 26/30 (86.67%), Postives = 28/30 (93.33%), Query Frame = 0
BLAST of MS017884 vs. ExPASy TrEMBL
Match: A0A4Y5RBG9 (Photosystem II protein D1 OS=Hydnocarpus hainanensis OX=593753 GN=psbA PE=3 SV=1) HSP 1 Score: 59.7 bits (143), Expect = 2.4e-06 Identity = 26/30 (86.67%), Postives = 28/30 (93.33%), Query Frame = 0
BLAST of MS017884 vs. ExPASy TrEMBL
Match: A0A7J7LAM9 (32 kDa thylakoid membrane protein OS=Kingdonia uniflora OX=39325 GN=GIB67_006674 PE=3 SV=1) HSP 1 Score: 59.7 bits (143), Expect = 2.4e-06 Identity = 26/30 (86.67%), Postives = 28/30 (93.33%), Query Frame = 0
BLAST of MS017884 vs. TAIR 10
Match: ATCG00020.1 (photosystem II reaction center protein A ) HSP 1 Score: 59.3 bits (142), Expect = 6.1e-10 Identity = 26/30 (86.67%), Postives = 27/30 (90.00%), Query Frame = 0
The following BLAST results are available for this feature:
Relationships
The following mRNA feature(s) are a part of this gene:
|