MS011437 (gene) Bitter gourd (TR) v1
Overview
Sequences
The following sequences are available for this feature:
Legend: CDSpolypeptide Hold the cursor over a type above to highlight its positions in the sequence below.AGCTGCTTAAATTTTGGTCATCAAGATTTTCTGGAACTTGCTGTAGAAGATTTCAATATCCTGCAATCCATACATCATAAAGAACTGAAAGAGCTTGAAAGG AGCTGCTTAAATTTTGGTCATCAAGATTTTCTGGAACTTGCTGTAGAAGATTTCAATATCCTGCAATCCATACATCATAAAGAACTGAAAGAGCTTGAAAGG AGCTGCTTAAATTTTGGTCATCAAGATTTTCTGGAACTTGCTGTAGAAGATTTCAATATCCTGCAATCCATACATCATAAAGAACTGAAAGAGCTTGAAAGG SCLNFGHQDFLELAVEDFNILQSIHHKELKELER Homology
BLAST of MS011437 vs. NCBI nr
Match: XP_022147908.1 (ent-kaur-16-ene synthase, chloroplastic isoform X1 [Momordica charantia]) HSP 1 Score: 71.6 bits (174), Expect = 1.4e-09 Identity = 33/34 (97.06%), Postives = 34/34 (100.00%), Query Frame = 0
BLAST of MS011437 vs. NCBI nr
Match: XP_022147910.1 (ent-kaur-16-ene synthase, chloroplastic isoform X3 [Momordica charantia]) HSP 1 Score: 71.6 bits (174), Expect = 1.4e-09 Identity = 33/34 (97.06%), Postives = 34/34 (100.00%), Query Frame = 0
BLAST of MS011437 vs. NCBI nr
Match: XP_022147909.1 (ent-kaur-16-ene synthase, chloroplastic isoform X2 [Momordica charantia]) HSP 1 Score: 71.6 bits (174), Expect = 1.4e-09 Identity = 33/34 (97.06%), Postives = 34/34 (100.00%), Query Frame = 0
BLAST of MS011437 vs. NCBI nr
Match: NP_001292675.1 (ent-kaur-16-ene synthase, chloroplastic [Cucumis sativus] >XP_004139844.2 ent-kaur-16-ene synthase, chloroplastic isoform X1 [Cucumis sativus] >BAB19275.1 ent-kaurene synthase [Cucumis sativus]) HSP 1 Score: 63.9 bits (154), Expect = 3.0e-07 Identity = 29/34 (85.29%), Postives = 31/34 (91.18%), Query Frame = 0
BLAST of MS011437 vs. NCBI nr
Match: XP_011659051.1 (ent-kaur-16-ene synthase, chloroplastic isoform X2 [Cucumis sativus]) HSP 1 Score: 63.9 bits (154), Expect = 3.0e-07 Identity = 29/34 (85.29%), Postives = 31/34 (91.18%), Query Frame = 0
BLAST of MS011437 vs. ExPASy Swiss-Prot
Match: Q39548 (Ent-kaur-16-ene synthase, chloroplastic OS=Cucurbita maxima OX=3661 PE=1 SV=1) HSP 1 Score: 60.8 bits (146), Expect = 3.3e-09 Identity = 28/34 (82.35%), Postives = 31/34 (91.18%), Query Frame = 0
BLAST of MS011437 vs. ExPASy Swiss-Prot
Match: A0A3G1QTS7 (Ent-kaurene synthase 1, chloroplastic OS=Isodon eriocalyx OX=662907 GN=KS1 PE=1 SV=1) HSP 1 Score: 46.2 bits (108), Expect = 8.5e-05 Identity = 21/31 (67.74%), Postives = 26/31 (83.87%), Query Frame = 0
BLAST of MS011437 vs. ExPASy Swiss-Prot
Match: A0A1Z3GC64 (Ent-kaurene synthase 5, chloroplastic OS=Isodon rubescens OX=587669 GN=KSL5 PE=1 SV=1) HSP 1 Score: 46.2 bits (108), Expect = 8.5e-05 Identity = 21/31 (67.74%), Postives = 26/31 (83.87%), Query Frame = 0
BLAST of MS011437 vs. ExPASy Swiss-Prot
Match: A0A1W6QDI6 (Terpene synthase 6, chloroplastic (Fragment) OS=Isodon rubescens OX=587669 GN=TPS6 PE=2 SV=1) HSP 1 Score: 46.2 bits (108), Expect = 8.5e-05 Identity = 21/31 (67.74%), Postives = 26/31 (83.87%), Query Frame = 0
BLAST of MS011437 vs. ExPASy Swiss-Prot
Match: A0A2K9RFY0 (Ent-kaurene synthase TSP4, chloroplastic OS=Vitex agnus-castus OX=54477 GN=TPS4 PE=1 SV=1) HSP 1 Score: 43.5 bits (101), Expect = 5.5e-04 Identity = 19/31 (61.29%), Postives = 27/31 (87.10%), Query Frame = 0
BLAST of MS011437 vs. ExPASy TrEMBL
Match: A0A6J1D2L1 (ent-kaur-16-ene synthase, chloroplastic isoform X1 OS=Momordica charantia OX=3673 GN=LOC111016726 PE=4 SV=1) HSP 1 Score: 71.6 bits (174), Expect = 7.0e-10 Identity = 33/34 (97.06%), Postives = 34/34 (100.00%), Query Frame = 0
BLAST of MS011437 vs. ExPASy TrEMBL
Match: A0A6J1D2F0 (ent-kaur-16-ene synthase, chloroplastic isoform X2 OS=Momordica charantia OX=3673 GN=LOC111016726 PE=4 SV=1) HSP 1 Score: 71.6 bits (174), Expect = 7.0e-10 Identity = 33/34 (97.06%), Postives = 34/34 (100.00%), Query Frame = 0
BLAST of MS011437 vs. ExPASy TrEMBL
Match: A0A6J1D1G1 (ent-kaur-16-ene synthase, chloroplastic isoform X3 OS=Momordica charantia OX=3673 GN=LOC111016726 PE=4 SV=1) HSP 1 Score: 71.6 bits (174), Expect = 7.0e-10 Identity = 33/34 (97.06%), Postives = 34/34 (100.00%), Query Frame = 0
BLAST of MS011437 vs. ExPASy TrEMBL
Match: Q9FRX5 (Ent-kaurene synthase OS=Cucumis sativus OX=3659 GN=CsKS1 PE=2 SV=1) HSP 1 Score: 63.9 bits (154), Expect = 1.5e-07 Identity = 29/34 (85.29%), Postives = 31/34 (91.18%), Query Frame = 0
BLAST of MS011437 vs. ExPASy TrEMBL
Match: A0A1S3BGJ9 (ent-kaur-16-ene synthase, chloroplastic isoform X3 OS=Cucumis melo OX=3656 GN=LOC103489622 PE=4 SV=1) HSP 1 Score: 63.5 bits (153), Expect = 1.9e-07 Identity = 29/34 (85.29%), Postives = 31/34 (91.18%), Query Frame = 0
The following BLAST results are available for this feature:
InterPro
Analysis Name: InterPro Annotations of Bitter gourd (TR) v1
Date Performed: 2021-10-25
Relationships
The following mRNA feature(s) are a part of this gene:
GO Annotation
GO Assignments
This gene is annotated with the following GO terms.
|