MS009619 (gene) Bitter gourd (TR) v1
Overview
Sequences
The following sequences are available for this feature:
Legend: CDSpolypeptide Hold the cursor over a type above to highlight its positions in the sequence below.GCGCAACCAGAGACGCTGCAAGTAGTTCAAGCAACAATCGCGAAGCAACTCTCTCGGGATGAGAGCACTGTGATCCCTCAAACAAAGTTTACTGATTTGGGAGCTGATTCTCTTGACATAGTGAGTTCTCCTTTGGACTATAAAGTTTTTATGTTTTAAAAAATTATGTTGACTTTTTTTTTTGGATTTCTCTCGTAATGTTTTTCTTACCATTCTTACGAATAGATTTAGAAAACAAAAAACAAAATCGTTATCATACAACTAACGAAAAGATACTCACAGGTTGAGATTATGATGACTTTGGAAGAGAAGTTCGGAGTTTCCATCGGAGAAGGCGGGGCCGAGGGCATTTCGACCGTTCAAGACGCTGCCGATCTGATCGAGAAAGTCAAGGCATCCGCTGCAAGT GCGCAACCAGAGACGCTGCAAGTAGTTCAAGCAACAATCGCGAAGCAACTCTCTCGGGATGAGAGCACTGTGATCCCTCAAACAAAGTTTACTGATTTGGGAGCTGATTCTCTTGACATAGTTGAGATTATGATGACTTTGGAAGAGAAGTTCGGAGTTTCCATCGGAGAAGGCGGGGCCGAGGGCATTTCGACCGTTCAAGACGCTGCCGATCTGATCGAGAAAGTCAAGGCATCCGCTGCAAGT GCGCAACCAGAGACGCTGCAAGTAGTTCAAGCAACAATCGCGAAGCAACTCTCTCGGGATGAGAGCACTGTGATCCCTCAAACAAAGTTTACTGATTTGGGAGCTGATTCTCTTGACATAGTTGAGATTATGATGACTTTGGAAGAGAAGTTCGGAGTTTCCATCGGAGAAGGCGGGGCCGAGGGCATTTCGACCGTTCAAGACGCTGCCGATCTGATCGAGAAAGTCAAGGCATCCGCTGCAAGT AQPETLQVVQATIAKQLSRDESTVIPQTKFTDLGADSLDIVEIMMTLEEKFGVSIGEGGAEGISTVQDAADLIEKVKASAAS Homology
BLAST of MS009619 vs. NCBI nr
Match: XP_022151601.1 (uncharacterized protein LOC111019509 [Momordica charantia]) HSP 1 Score: 150.2 bits (378), Expect = 7.7e-33 Identity = 82/82 (100.00%), Postives = 82/82 (100.00%), Query Frame = 0
BLAST of MS009619 vs. NCBI nr
Match: XP_008462263.1 (PREDICTED: acyl carrier protein-like isoform X2 [Cucumis melo]) HSP 1 Score: 131.0 bits (328), Expect = 4.8e-27 Identity = 71/82 (86.59%), Postives = 76/82 (92.68%), Query Frame = 0
BLAST of MS009619 vs. NCBI nr
Match: XP_008462262.1 (PREDICTED: acyl carrier protein 1, chloroplastic-like isoform X1 [Cucumis melo]) HSP 1 Score: 131.0 bits (328), Expect = 4.8e-27 Identity = 71/82 (86.59%), Postives = 76/82 (92.68%), Query Frame = 0
BLAST of MS009619 vs. NCBI nr
Match: KAA0059374.1 (acyl carrier protein 1 [Cucumis melo var. makuwa] >TYK03952.1 acyl carrier protein 1 [Cucumis melo var. makuwa]) HSP 1 Score: 131.0 bits (328), Expect = 4.8e-27 Identity = 71/82 (86.59%), Postives = 76/82 (92.68%), Query Frame = 0
BLAST of MS009619 vs. NCBI nr
Match: XP_038897463.1 (acyl carrier protein-like [Benincasa hispida]) HSP 1 Score: 130.6 bits (327), Expect = 6.3e-27 Identity = 71/82 (86.59%), Postives = 75/82 (91.46%), Query Frame = 0
BLAST of MS009619 vs. ExPASy Swiss-Prot
Match: P93092 (Acyl carrier protein 1, chloroplastic OS=Casuarina glauca OX=3522 GN=ACP1 PE=2 SV=1) HSP 1 Score: 80.1 bits (196), Expect = 1.3e-14 Identity = 44/77 (57.14%), Postives = 60/77 (77.92%), Query Frame = 0
BLAST of MS009619 vs. ExPASy Swiss-Prot
Match: P32887 (Acyl carrier protein, chloroplastic OS=Brassica napus OX=3708 GN=ACL1.A3 PE=2 SV=1) HSP 1 Score: 76.3 bits (186), Expect = 1.9e-13 Identity = 40/77 (51.95%), Postives = 59/77 (76.62%), Query Frame = 0
BLAST of MS009619 vs. ExPASy Swiss-Prot
Match: P17650 (Acyl carrier protein, chloroplastic OS=Brassica napus OX=3708 GN=ACL1.A2 PE=2 SV=1) HSP 1 Score: 75.9 bits (185), Expect = 2.4e-13 Identity = 40/77 (51.95%), Postives = 59/77 (76.62%), Query Frame = 0
BLAST of MS009619 vs. ExPASy Swiss-Prot
Match: P07088 (Acyl carrier protein SF2, chloroplastic OS=Brassica campestris OX=3711 GN=Acl1.1 PE=2 SV=1) HSP 1 Score: 75.9 bits (185), Expect = 2.4e-13 Identity = 40/77 (51.95%), Postives = 59/77 (76.62%), Query Frame = 0
BLAST of MS009619 vs. ExPASy Swiss-Prot
Match: P52411 (Acyl carrier protein 1, chloroplastic OS=Cuphea lanceolata OX=3930 GN=ACL1.1 PE=2 SV=1) HSP 1 Score: 75.5 bits (184), Expect = 3.2e-13 Identity = 44/77 (57.14%), Postives = 57/77 (74.03%), Query Frame = 0
BLAST of MS009619 vs. ExPASy TrEMBL
Match: A0A6J1DF56 (Acyl carrier protein OS=Momordica charantia OX=3673 GN=LOC111019509 PE=3 SV=1) HSP 1 Score: 150.2 bits (378), Expect = 3.7e-33 Identity = 82/82 (100.00%), Postives = 82/82 (100.00%), Query Frame = 0
BLAST of MS009619 vs. ExPASy TrEMBL
Match: A0A5A7UWB3 (Acyl carrier protein OS=Cucumis melo var. makuwa OX=1194695 GN=E5676_scaffold347G001490 PE=3 SV=1) HSP 1 Score: 131.0 bits (328), Expect = 2.3e-27 Identity = 71/82 (86.59%), Postives = 76/82 (92.68%), Query Frame = 0
BLAST of MS009619 vs. ExPASy TrEMBL
Match: A0A1S3CGH5 (Acyl carrier protein OS=Cucumis melo OX=3656 GN=LOC103500663 PE=3 SV=1) HSP 1 Score: 131.0 bits (328), Expect = 2.3e-27 Identity = 71/82 (86.59%), Postives = 76/82 (92.68%), Query Frame = 0
BLAST of MS009619 vs. ExPASy TrEMBL
Match: A0A1S3CGK8 (Acyl carrier protein OS=Cucumis melo OX=3656 GN=LOC103500663 PE=3 SV=1) HSP 1 Score: 131.0 bits (328), Expect = 2.3e-27 Identity = 71/82 (86.59%), Postives = 76/82 (92.68%), Query Frame = 0
BLAST of MS009619 vs. ExPASy TrEMBL
Match: A0A0A0K6W2 (Acyl carrier protein OS=Cucumis sativus OX=3659 GN=Csa_7G448710 PE=3 SV=1) HSP 1 Score: 129.8 bits (325), Expect = 5.2e-27 Identity = 70/82 (85.37%), Postives = 76/82 (92.68%), Query Frame = 0
BLAST of MS009619 vs. TAIR 10
Match: AT3G05020.1 (acyl carrier protein 1 ) HSP 1 Score: 70.9 bits (172), Expect = 5.5e-13 Identity = 39/77 (50.65%), Postives = 56/77 (72.73%), Query Frame = 0
BLAST of MS009619 vs. TAIR 10
Match: AT5G27200.1 (acyl carrier protein 5 ) HSP 1 Score: 70.9 bits (172), Expect = 5.5e-13 Identity = 40/74 (54.05%), Postives = 55/74 (74.32%), Query Frame = 0
BLAST of MS009619 vs. TAIR 10
Match: AT1G54580.1 (acyl carrier protein 2 ) HSP 1 Score: 68.6 bits (166), Expect = 2.7e-12 Identity = 39/77 (50.65%), Postives = 54/77 (70.13%), Query Frame = 0
BLAST of MS009619 vs. TAIR 10
Match: AT1G54630.1 (acyl carrier protein 3 ) HSP 1 Score: 68.6 bits (166), Expect = 2.7e-12 Identity = 39/77 (50.65%), Postives = 54/77 (70.13%), Query Frame = 0
BLAST of MS009619 vs. TAIR 10
Match: AT4G25050.1 (acyl carrier protein 4 ) HSP 1 Score: 66.6 bits (161), Expect = 1.0e-11 Identity = 37/75 (49.33%), Postives = 54/75 (72.00%), Query Frame = 0
The following BLAST results are available for this feature:
InterPro
Analysis Name: InterPro Annotations of Bitter gourd (TR) v1
Date Performed: 2021-10-25
Relationships
The following mRNA feature(s) are a part of this gene:
GO Annotation
GO Assignments
This gene is annotated with the following GO terms.
|