MS005442 (gene) Bitter gourd (TR) v1
|
Overview
Sequences
The following sequences are available for this feature:
Legend: polypeptideCDS Hold the cursor over a type above to highlight its positions in the sequence below.TGGAATTTGTGGCGTCAACCTATAGGGTTTGTTACTTTTCTAATTTCTCCCTTAGCAGAGAATGCGAGAGATTACCTTTTGATTTACCGAAATGGAATTTGTGGCGTCAACCTATAGGGTTTGTTACTTTTCTAATTTCTCCCTTAGAATGCGAGAGATTACCTTTTGATTTACCGAAA TGGAATTTGTGGCGTCAACCTATAGGGTTTGTTACTTTTCTAATTTCTCCCTTAGAATGCGAGAGATTACCTTTTGATTTACCGAAA WNLWRQPIGFVTFLISPLECERLPFDLPK Homology
BLAST of MS005442 vs. NCBI nr
Match: RYR67074.1 (hypothetical protein Ahy_A03g013321 [Arachis hypogaea]) HSP 1 Score: 60.8 bits (146), Expect = 2.2e-06 Identity = 27/30 (90.00%), Postives = 27/30 (90.00%), Query Frame = 0
BLAST of MS005442 vs. NCBI nr
Match: QFQ42898.1 (NADH-plastoquinone oxidoreductase subunit 1 [Phyllagathis setotheca var. setotuba]) HSP 1 Score: 60.8 bits (146), Expect = 2.2e-06 Identity = 26/30 (86.67%), Postives = 28/30 (93.33%), Query Frame = 0
BLAST of MS005442 vs. NCBI nr
Match: QTJ25846.1 (NdhA [Impatiens linearisepala]) HSP 1 Score: 60.8 bits (146), Expect = 2.2e-06 Identity = 26/30 (86.67%), Postives = 28/30 (93.33%), Query Frame = 0
BLAST of MS005442 vs. NCBI nr
Match: YP_009562269.1 (NADH-plastoquinone oxidoreductase subunit 1 [Trichomanes trollii] >QAV57626.1 NADH-plastoquinone oxidoreductase subunit 1 [Trichomanes trollii]) HSP 1 Score: 60.5 bits (145), Expect = 2.8e-06 Identity = 25/30 (83.33%), Postives = 27/30 (90.00%), Query Frame = 0
BLAST of MS005442 vs. NCBI nr
Match: AXZ97060.1 (NADH dehydrogenase subunit 1 [Callistopteris apiifolia]) HSP 1 Score: 60.5 bits (145), Expect = 2.8e-06 Identity = 25/30 (83.33%), Postives = 27/30 (90.00%), Query Frame = 0
BLAST of MS005442 vs. ExPASy Swiss-Prot
Match: Q8S8U5 (NAD(P)H-quinone oxidoreductase subunit 1, chloroplastic OS=Atropa belladonna OX=33113 GN=ndhA PE=3 SV=1) HSP 1 Score: 58.9 bits (141), Expect = 1.1e-08 Identity = 25/30 (83.33%), Postives = 27/30 (90.00%), Query Frame = 0
BLAST of MS005442 vs. ExPASy Swiss-Prot
Match: Q7YJS9 (NAD(P)H-quinone oxidoreductase subunit 1, chloroplastic OS=Calycanthus floridus var. glaucus OX=212734 GN=ndhA PE=3 SV=1) HSP 1 Score: 58.9 bits (141), Expect = 1.1e-08 Identity = 25/30 (83.33%), Postives = 27/30 (90.00%), Query Frame = 0
BLAST of MS005442 vs. ExPASy Swiss-Prot
Match: Q09MC1 (NAD(P)H-quinone oxidoreductase subunit 1, chloroplastic OS=Citrus sinensis OX=2711 GN=ndhA PE=3 SV=1) HSP 1 Score: 58.9 bits (141), Expect = 1.1e-08 Identity = 25/30 (83.33%), Postives = 27/30 (90.00%), Query Frame = 0
BLAST of MS005442 vs. ExPASy Swiss-Prot
Match: Q2QD36 (NAD(P)H-quinone oxidoreductase subunit 1, chloroplastic OS=Cucumis sativus OX=3659 GN=ndhA PE=3 SV=1) HSP 1 Score: 58.9 bits (141), Expect = 1.1e-08 Identity = 26/30 (86.67%), Postives = 27/30 (90.00%), Query Frame = 0
BLAST of MS005442 vs. ExPASy Swiss-Prot
Match: Q0G9Q7 (NAD(P)H-quinone oxidoreductase subunit 1, chloroplastic OS=Daucus carota OX=4039 GN=ndhA PE=3 SV=1) HSP 1 Score: 58.9 bits (141), Expect = 1.1e-08 Identity = 25/30 (83.33%), Postives = 27/30 (90.00%), Query Frame = 0
BLAST of MS005442 vs. ExPASy TrEMBL
Match: A0A445DV65 (ATP-synt_ab_N domain-containing protein OS=Arachis hypogaea OX=3818 GN=Ahy_A03g013321 PE=3 SV=1) HSP 1 Score: 60.8 bits (146), Expect = 1.1e-06 Identity = 27/30 (90.00%), Postives = 27/30 (90.00%), Query Frame = 0
BLAST of MS005442 vs. ExPASy TrEMBL
Match: A0A5P8GIX6 (NAD(P)H-quinone oxidoreductase subunit 1, chloroplastic OS=Phyllagathis setotheca var. setotuba OX=2293682 GN=ndhA PE=3 SV=1) HSP 1 Score: 60.8 bits (146), Expect = 1.1e-06 Identity = 26/30 (86.67%), Postives = 28/30 (93.33%), Query Frame = 0
BLAST of MS005442 vs. ExPASy TrEMBL
Match: A0A410YEM7 (NAD(P)H-quinone oxidoreductase subunit 1, chloroplastic OS=Trichomanes trollii OX=1481379 GN=ndhA PE=3 SV=1) HSP 1 Score: 60.5 bits (145), Expect = 1.4e-06 Identity = 25/30 (83.33%), Postives = 27/30 (90.00%), Query Frame = 0
BLAST of MS005442 vs. ExPASy TrEMBL
Match: H2FC84 (NADH-plastoquinone oxidoreductase subunit 1 (Fragment) OS=Eucharis grandiflora OX=44989 GN=ndhA PE=3 SV=1) HSP 1 Score: 60.5 bits (145), Expect = 1.4e-06 Identity = 26/30 (86.67%), Postives = 27/30 (90.00%), Query Frame = 0
BLAST of MS005442 vs. ExPASy TrEMBL
Match: A0A385KP62 (NAD(P)H-quinone oxidoreductase subunit 1, chloroplastic OS=Callistopteris apiifolia OX=221309 GN=ndhA PE=3 SV=1) HSP 1 Score: 60.5 bits (145), Expect = 1.4e-06 Identity = 25/30 (83.33%), Postives = 27/30 (90.00%), Query Frame = 0
BLAST of MS005442 vs. TAIR 10
Match: ATCG01100.1 (NADH dehydrogenase family protein ) HSP 1 Score: 58.5 bits (140), Expect = 1.0e-09 Identity = 25/30 (83.33%), Postives = 27/30 (90.00%), Query Frame = 0
The following BLAST results are available for this feature:
Relationships
The following mRNA feature(s) are a part of this gene:
|