
MC11g0734 (gene) Bitter gourd (Dali-11) v1
Overview
Sequences
The following sequences are available for this feature:
Legend: CDSpolypeptide Hold the cursor over a type above to highlight its positions in the sequence below.CGTAAGATAGTTAAAGTACGGTTGAACAATCGACATTATCATAATTTGCAGGAGCATTATGTGGTGTTAATAGGAGGAGGTAGAGTGAAAGATTCGCGAGCTGTA CGTAAGATAGTTAAAGTACGGTTGAACAATCGACATTATCATAATTTGCAGGAGCATTATGTGGTGTTAATAGGAGGAGGTAGAGTGAAAGATTCGCGAGCTGTA CGTAAGATAGTTAAAGTACGGTTGAACAATCGACATTATCATAATTTGCAGGAGCATTATGTGGTGTTAATAGGAGGAGGTAGAGTGAAAGATTCGCGAGCTGTA RKIVKVRLNNRHYHNLQEHYVVLIGGGRVKDSRAV Homology
BLAST of MC11g0734 vs. ExPASy Swiss-Prot
Match: P68535 (Ribosomal protein S12, mitochondrial OS=Petunia hybrida OX=4102 GN=RPS12 PE=3 SV=1) HSP 1 Score: 47.8 bits (112), Expect = 3.0e-05 Identity = 27/44 (61.36%), Postives = 29/44 (65.91%), Query Frame = 0
BLAST of MC11g0734 vs. ExPASy Swiss-Prot
Match: P68536 (Ribosomal protein S12, mitochondrial OS=Petunia parodii OX=55890 GN=RPS12 PE=3 SV=1) HSP 1 Score: 47.8 bits (112), Expect = 3.0e-05 Identity = 27/44 (61.36%), Postives = 29/44 (65.91%), Query Frame = 0
BLAST of MC11g0734 vs. ExPASy Swiss-Prot
Match: Q96033 (Ribosomal protein S12, mitochondrial OS=Helianthus annuus OX=4232 GN=RPS12 PE=2 SV=1) HSP 1 Score: 45.8 bits (107), Expect = 1.1e-04 Identity = 25/40 (62.50%), Postives = 27/40 (67.50%), Query Frame = 0
BLAST of MC11g0734 vs. ExPASy Swiss-Prot
Match: P28520 (Ribosomal protein S12, mitochondrial OS=Oryza sativa subsp. japonica OX=39947 GN=RPS12 PE=3 SV=1) HSP 1 Score: 45.8 bits (107), Expect = 1.1e-04 Identity = 25/44 (56.82%), Postives = 28/44 (63.64%), Query Frame = 0
BLAST of MC11g0734 vs. ExPASy Swiss-Prot
Match: P60099 (Ribosomal protein S12, mitochondrial OS=Zea mays OX=4577 GN=RPS12 PE=2 SV=1) HSP 1 Score: 45.4 bits (106), Expect = 1.5e-04 Identity = 24/40 (60.00%), Postives = 27/40 (67.50%), Query Frame = 0
BLAST of MC11g0734 vs. NCBI nr
Match: YP_009239006.1 (ribosomal protein S12 [Salix purpurea] >YP_009745346.1 ribosomal protein S12 [Salix paraflabellaris] >YP_009988231.1 ribosomal protein S12 [Salix cardiophylla] >AMO27190.1 ribosomal protein S12 [Salix purpurea] >QIH29792.1 ribosomal protein S12 [Salix paraflabellaris] >QNM38477.1 ribosomal protein S12 [Salix cardiophylla]) HSP 1 Score: 48.9 bits (115), Expect = 1.06e-05 Identity = 28/44 (63.64%), Postives = 30/44 (68.18%), Query Frame = 0
BLAST of MC11g0734 vs. NCBI nr
Match: YP_009173845.1 (ribosomal protein S12 [Populus tremula] >YP_009178742.1 ribosomal protein S12 [Populus tremula x Populus alba] >YP_009389190.1 ribosomal protein S12 [Populus davidiana] >YP_009560693.1 ribosomal protein S12 [Populus alba] >QTG40185.1 ribosomal protein S12 [Populus rotundifolia var. duclouxiana] >ALH07317.1 ribosomal protein S12 [Populus tremula] >ALJ49773.1 ribosomal protein S12 [Populus tremula x Populus alba] >ARX79197.1 ribosomal protein S12 [Populus davidiana] >QAA78992.1 ribosomal protein S12 [Populus alba]) HSP 1 Score: 48.9 bits (115), Expect = 1.06e-05 Identity = 28/44 (63.64%), Postives = 30/44 (68.18%), Query Frame = 0
BLAST of MC11g0734 vs. NCBI nr
Match: YP_009230378.1 (ribosomal protein S12 [Salix suchowensis] >AMF83899.1 ribosomal protein S12 [Salix suchowensis]) HSP 1 Score: 48.9 bits (115), Expect = 1.14e-05 Identity = 28/44 (63.64%), Postives = 30/44 (68.18%), Query Frame = 0
BLAST of MC11g0734 vs. NCBI nr
Match: KAG6736890.1 (hypothetical protein POTOM_060180 [Populus tomentosa]) HSP 1 Score: 48.9 bits (115), Expect = 1.77e-05 Identity = 28/44 (63.64%), Postives = 30/44 (68.18%), Query Frame = 0
BLAST of MC11g0734 vs. NCBI nr
Match: QKI32043.1 (ribosomal protein S12 [Ombrophytum subterraneum]) HSP 1 Score: 48.1 bits (113), Expect = 2.11e-05 Identity = 27/44 (61.36%), Postives = 29/44 (65.91%), Query Frame = 0
BLAST of MC11g0734 vs. ExPASy TrEMBL
Match: A0A7G3UZ89 (Ribosomal protein S12 (Fragment) OS=Thismia panamensis OX=396677 GN=rps12 PE=3 SV=1) HSP 1 Score: 48.9 bits (115), Expect = 4.61e-06 Identity = 26/44 (59.09%), Postives = 29/44 (65.91%), Query Frame = 0
BLAST of MC11g0734 vs. ExPASy TrEMBL
Match: A0A7G9ISY3 (Ribosomal protein S12 OS=Salix cardiophylla OX=688335 GN=rps12 PE=3 SV=1) HSP 1 Score: 48.9 bits (115), Expect = 5.14e-06 Identity = 28/44 (63.64%), Postives = 30/44 (68.18%), Query Frame = 0
BLAST of MC11g0734 vs. ExPASy TrEMBL
Match: A0A343DRA4 (Ribosomal protein S12 OS=Populus davidiana OX=266767 GN=rps12 PE=3 SV=1) HSP 1 Score: 48.9 bits (115), Expect = 5.14e-06 Identity = 28/44 (63.64%), Postives = 30/44 (68.18%), Query Frame = 0
BLAST of MC11g0734 vs. ExPASy TrEMBL
Match: A0A451FPL0 (Ribosomal protein S12 OS=Populus alba OX=43335 GN=rps12 PE=3 SV=1) HSP 1 Score: 48.9 bits (115), Expect = 5.14e-06 Identity = 28/44 (63.64%), Postives = 30/44 (68.18%), Query Frame = 0
BLAST of MC11g0734 vs. ExPASy TrEMBL
Match: A0A140HP93 (Ribosomal protein S12 OS=Salix purpurea OX=77065 GN=rps12 PE=3 SV=1) HSP 1 Score: 48.9 bits (115), Expect = 5.14e-06 Identity = 28/44 (63.64%), Postives = 30/44 (68.18%), Query Frame = 0
BLAST of MC11g0734 vs. TAIR 10
Match: AT2G07675.1 (Ribosomal protein S12/S23 family protein ) HSP 1 Score: 45.1 bits (105), Expect = 1.4e-05 Identity = 26/44 (59.09%), Postives = 27/44 (61.36%), Query Frame = 0
BLAST of MC11g0734 vs. TAIR 10
Match: ATMG00980.1 (Ribosomal protein S12/S23 family protein ) HSP 1 Score: 45.1 bits (105), Expect = 1.4e-05 Identity = 26/44 (59.09%), Postives = 27/44 (61.36%), Query Frame = 0
The following BLAST results are available for this feature:
InterPro
Analysis Name: InterPro Annotations of Bitter gourd (Dali-11) v1
Date Performed: 2021-10-25 Position : 0 Zoom : x 1
Relationships
The following mRNA feature(s) are a part of this gene:
GO Annotation
GO Assignments
This gene is annotated with the following GO terms.
|