MC04g0166 (gene) Bitter gourd (Dali-11) v1
Overview
Sequences
The following sequences are available for this feature:
Legend: CDSpolypeptide Hold the cursor over a type above to highlight its positions in the sequence below.ATCGCTGTGGAATTTGATACCAATTTCGACCCTTCATTTGGTGACATCAATGGAAATCATATAGGTATTGATGTCAGT ATCGCTGTGGAATTTGATACCAATTTCGACCCTTCATTTGGTGACATCAATGGAAATCATATAGGTATTGATGTCAGT ATCGCTGTGGAATTTGATACCAATTTCGACCCTTCATTTGGTGACATCAATGGAAATCATATAGGTATTGATGTCAGT IAVEFDTNFDPSFGDINGNHIGIDVS Homology
BLAST of MC04g0166 vs. ExPASy Swiss-Prot
Match: Q9FHX3 (L-type lectin-domain containing receptor kinase S.6 OS=Arabidopsis thaliana OX=3702 GN=LECRKS6 PE=2 SV=1) HSP 1 Score: 47.0 bits (110), Expect = 3.8e-05 Identity = 21/26 (80.77%), Postives = 22/26 (84.62%), Query Frame = 0
BLAST of MC04g0166 vs. ExPASy Swiss-Prot
Match: Q9FHG4 (Probable L-type lectin-domain containing receptor kinase S.7 OS=Arabidopsis thaliana OX=3702 GN=LECRKS7 PE=2 SV=1) HSP 1 Score: 42.7 bits (99), Expect = 7.2e-04 Identity = 17/25 (68.00%), Postives = 20/25 (80.00%), Query Frame = 0
BLAST of MC04g0166 vs. NCBI nr
Match: XP_030444506.1 (L-type lectin-domain containing receptor kinase S.6 [Syzygium oleosum]) HSP 1 Score: 49.7 bits (117), Expect = 1.38e-05 Identity = 22/26 (84.62%), Postives = 25/26 (96.15%), Query Frame = 0
BLAST of MC04g0166 vs. NCBI nr
Match: XP_030544080.1 (L-type lectin-domain containing receptor kinase S.6 [Rhodamnia argentea]) HSP 1 Score: 49.7 bits (117), Expect = 1.38e-05 Identity = 22/26 (84.62%), Postives = 25/26 (96.15%), Query Frame = 0
BLAST of MC04g0166 vs. NCBI nr
Match: XP_010063880.2 (L-type lectin-domain containing receptor kinase S.6 [Eucalyptus grandis]) HSP 1 Score: 49.7 bits (117), Expect = 1.38e-05 Identity = 22/26 (84.62%), Postives = 25/26 (96.15%), Query Frame = 0
BLAST of MC04g0166 vs. NCBI nr
Match: KCW71162.1 (hypothetical protein EUGRSUZ_F04258 [Eucalyptus grandis]) HSP 1 Score: 49.7 bits (117), Expect = 1.38e-05 Identity = 22/26 (84.62%), Postives = 25/26 (96.15%), Query Frame = 0
BLAST of MC04g0166 vs. NCBI nr
Match: XP_006473038.1 (L-type lectin-domain containing receptor kinase S.6 [Citrus sinensis]) HSP 1 Score: 49.3 bits (116), Expect = 1.89e-05 Identity = 22/25 (88.00%), Postives = 24/25 (96.00%), Query Frame = 0
BLAST of MC04g0166 vs. ExPASy TrEMBL
Match: A0A059BYF3 (Protein kinase domain-containing protein OS=Eucalyptus grandis OX=71139 GN=EUGRSUZ_F04258 PE=3 SV=1) HSP 1 Score: 49.7 bits (117), Expect = 6.68e-06 Identity = 22/26 (84.62%), Postives = 25/26 (96.15%), Query Frame = 0
BLAST of MC04g0166 vs. ExPASy TrEMBL
Match: V4T3E8 (Protein kinase domain-containing protein OS=Citrus clementina OX=85681 GN=CICLE_v10003430mg PE=3 SV=1) HSP 1 Score: 49.3 bits (116), Expect = 9.13e-06 Identity = 22/25 (88.00%), Postives = 24/25 (96.00%), Query Frame = 0
BLAST of MC04g0166 vs. ExPASy TrEMBL
Match: A0A161XXI0 (Protein kinase domain-containing protein OS=Daucus carota subsp. sativus OX=79200 GN=DCAR_010091 PE=3 SV=1) HSP 1 Score: 49.3 bits (116), Expect = 9.13e-06 Identity = 22/26 (84.62%), Postives = 24/26 (92.31%), Query Frame = 0
BLAST of MC04g0166 vs. ExPASy TrEMBL
Match: A0A5B7BAD8 (Protein kinase domain-containing protein OS=Davidia involucrata OX=16924 GN=Din_034577 PE=3 SV=1) HSP 1 Score: 49.3 bits (116), Expect = 9.16e-06 Identity = 22/26 (84.62%), Postives = 24/26 (92.31%), Query Frame = 0
BLAST of MC04g0166 vs. ExPASy TrEMBL
Match: A0A067GYD4 (Protein kinase domain-containing protein (Fragment) OS=Citrus sinensis OX=2711 GN=CISIN_1g047719mg PE=3 SV=1) HSP 1 Score: 49.3 bits (116), Expect = 9.16e-06 Identity = 22/25 (88.00%), Postives = 24/25 (96.00%), Query Frame = 0
BLAST of MC04g0166 vs. TAIR 10
Match: AT5G42120.1 (Concanavalin A-like lectin protein kinase family protein ) HSP 1 Score: 47.0 bits (110), Expect = 2.7e-06 Identity = 21/26 (80.77%), Postives = 22/26 (84.62%), Query Frame = 0
BLAST of MC04g0166 vs. TAIR 10
Match: AT5G55830.1 (Concanavalin A-like lectin protein kinase family protein ) HSP 1 Score: 42.7 bits (99), Expect = 5.1e-05 Identity = 17/25 (68.00%), Postives = 20/25 (80.00%), Query Frame = 0
BLAST of MC04g0166 vs. TAIR 10
Match: AT5G03140.1 (Concanavalin A-like lectin protein kinase family protein ) HSP 1 Score: 39.3 bits (90), Expect = 5.7e-04 Identity = 15/26 (57.69%), Postives = 21/26 (80.77%), Query Frame = 0
The following BLAST results are available for this feature:
InterPro
Analysis Name: InterPro Annotations of Bitter gourd (Dali-11) v1
Date Performed: 2021-10-25
Relationships
The following mRNA feature(s) are a part of this gene:
GO Annotation
GO Assignments
This gene is annotated with the following GO terms.
|