Lag0035006 (gene) Sponge gourd (AG‐4) v1
Overview
Sequences
The following sequences are available for this feature:
Legend: exonCDSpolypeptide Hold the cursor over a type above to highlight its positions in the sequence below.ATGTTGGAATCCTCCCCCGACGAGTTTTTGGAAACTAAATACGGACGCAGCCTGTGTCCCATCCTCTCCGTTGACAGGACTAGGGGCATAGGTGGTTTTGCTAGAATAGACAATAATGAGGTCACTGTTTTAGTAAACGATGCGGAGAAGGCTAGTGACATTGATCCACAAGAAACTCATCAAACTCTTGAAATAGTGGAAGCTAACTTGAGGAAAGCTCAGGGCAAGAGACAAACAATCGAGGCAAATTTAGCTCTTAGACGAGCTAGGACACGAGTAGAGGCTATCAATGACGTACCTAGTTAA ATGTTGGAATCCTCCCCCGACGAGTTTTTGGAAACTAAATACGGACGCAGCCTGTGTCCCATCCTCTCCGTTGACAGGACTAGGGGCATAGGTGGTTTTGCTAGAATAGACAATAATGAGGTCACTGTTTTAGTAAACGATGCGGAGAAGGCTAGTGACATTGATCCACAAGAAACTCATCAAACTCTTGAAATAGTGGAAGCTAACTTGAGGAAAGCTCAGGGCAAGAGACAAACAATCGAGGCAAATTTAGCTCTTAGACGAGCTAGGACACGAGTAGAGGCTATCAATGACGTACCTAGTTAA ATGTTGGAATCCTCCCCCGACGAGTTTTTGGAAACTAAATACGGACGCAGCCTGTGTCCCATCCTCTCCGTTGACAGGACTAGGGGCATAGGTGGTTTTGCTAGAATAGACAATAATGAGGTCACTGTTTTAGTAAACGATGCGGAGAAGGCTAGTGACATTGATCCACAAGAAACTCATCAAACTCTTGAAATAGTGGAAGCTAACTTGAGGAAAGCTCAGGGCAAGAGACAAACAATCGAGGCAAATTTAGCTCTTAGACGAGCTAGGACACGAGTAGAGGCTATCAATGACGTACCTAGTTAA MLESSPDEFLETKYGRSLCPILSVDRTRGIGGFARIDNNEVTVLVNDAEKASDIDPQETHQTLEIVEANLRKAQGKRQTIEANLALRRARTRVEAINDVPS Homology
BLAST of Lag0035006 vs. NCBI nr
Match: YP_009751744.1 (CF1 subunit epsilon [Herpetospermum pedunculosum] >QIT04477.1 CF1 subunit epsilon [Herpetospermum pedunculosum] >QJR52962.1 ATP synthase CF1 epsilon subunit [Herpetospermum pedunculosum]) HSP 1 Score: 124.0 bits (310), Expect = 7.3e-25 Identity = 66/72 (91.67%), Postives = 67/72 (93.06%), Query Frame = 0
BLAST of Lag0035006 vs. NCBI nr
Match: YP_009752081.1 (CF1 subunit epsilon [Dendrosicyos socotranus] >YP_009753095.1 CF1 subunit epsilon [Corallocarpus boehmii] >QIT05491.1 CF1 subunit epsilon [Dendrosicyos socotranus] >QIT06167.1 CF1 subunit epsilon [Corallocarpus boehmii]) HSP 1 Score: 123.6 bits (309), Expect = 9.5e-25 Identity = 65/72 (90.28%), Postives = 67/72 (93.06%), Query Frame = 0
BLAST of Lag0035006 vs. NCBI nr
Match: ASY96329.1 (ATP synthase CF1 epsilon subunit [Cucumis melo subsp. agrestis]) HSP 1 Score: 123.6 bits (309), Expect = 9.5e-25 Identity = 65/72 (90.28%), Postives = 67/72 (93.06%), Query Frame = 0
BLAST of Lag0035006 vs. NCBI nr
Match: ALO22128.1 (AtpE [Cucurbita ficifolia] >QWV60846.1 ATP synthase CF1 epsilon subunit [Cucurbita ficifolia] >QZL38791.1 ATP synthase CF1 epsilon subunit [Cucurbita ficifolia]) HSP 1 Score: 123.6 bits (309), Expect = 9.5e-25 Identity = 65/72 (90.28%), Postives = 67/72 (93.06%), Query Frame = 0
BLAST of Lag0035006 vs. NCBI nr
Match: YP_004841789.1 (ATP synthase CF1 epsilon subunit [Cucumis melo subsp. melo] >YP_009004050.1 ATP synthase CF1 epsilon subunit [Cucumis hystrix] >YP_009317392.1 ATP synthase CF1 epsilon subunit [Coccinia grandis] >YP_009325995.1 ATP synthase CF1 epsilon subunit [Citrullus lanatus] >YP_009348037.1 ATP synthase CF1 epsilon subunit [Citrullus mucosospermus] >YP_009420800.1 ATP synthase CF1 epsilon subunit [Citrullus colocynthis] >YP_009431563.1 ATP synthase CF1 epsilon subunit [Citrullus amarus] >YP_009431648.1 ATP synthase CF1 epsilon subunit [Citrullus rehmii] >YP_009456152.1 ATP synthase CF1 epsilon subunit [Lagenaria siceraria] >YP_009860079.1 ATP synthase CF1 epsilon subunit [Cucumis melo subsp. agrestis] >YP_247605.1 ATP synthase CF1 epsilon subunit [Cucumis sativus] >Q4VZG9.1 RecName: Full=ATP synthase epsilon chain, chloroplastic; AltName: Full=ATP synthase F1 sector epsilon subunit; AltName: Full=F-ATPase epsilon subunit [Cucumis sativus] >ALF03307.1 ATP synthase CF1 epsilon subunit [Cucumis sativus var. hardwickii] >APW82467.1 ATP synthase CF1 epsilon subunit [Citrullus lanatus subsp. vulgaris] >ASY96590.1 ATP synthase CF1 epsilon subunit [Cucumis melo var. conomon] >ASY96677.1 ATP synthase CF1 epsilon subunit [Cucumis melo var. makuwa] >ASY96764.1 ATP synthase CF1 epsilon subunit [Cucumis melo var. momordica] >ASY96851.1 ATP synthase CF1 epsilon subunit [Cucumis melo var. dudaim] >ASY96938.1 ATP synthase CF1 epsilon subunit [Cucumis melo var. cantalupo] >ASY97112.1 ATP synthase CF1 epsilon subunit [Cucumis melo var. inodorus] >ASY97286.1 ATP synthase CF1 epsilon subunit [Cucumis melo var. flexuosus] >AVE15337.1 AtpE [Cucumis sativus var. sativus] >QJF46389.1 ATP synthase CF1 epsilon subunit [Cucumis melo] >QNM38537.1 ATP synthase CF1 epsilon subunit [Lagenaria siceraria var. microcarpa] >QZL38599.1 CF1 subunit epsilon [Citrullus naudinianus] >QZL38687.1 CF1 subunit epsilon [Citrullus ecirrhosus]) HSP 1 Score: 123.6 bits (309), Expect = 9.5e-25 Identity = 65/72 (90.28%), Postives = 67/72 (93.06%), Query Frame = 0
BLAST of Lag0035006 vs. ExPASy Swiss-Prot
Match: Q4VZG9 (ATP synthase epsilon chain, chloroplastic OS=Cucumis sativus OX=3659 GN=atpE PE=3 SV=1) HSP 1 Score: 123.6 bits (309), Expect = 1.2e-27 Identity = 65/72 (90.28%), Postives = 67/72 (93.06%), Query Frame = 0
BLAST of Lag0035006 vs. ExPASy Swiss-Prot
Match: P09468 (ATP synthase epsilon chain, chloroplastic OS=Arabidopsis thaliana OX=3702 GN=atpE PE=1 SV=2) HSP 1 Score: 114.4 bits (285), Expect = 7.6e-25 Identity = 58/70 (82.86%), Postives = 64/70 (91.43%), Query Frame = 0
BLAST of Lag0035006 vs. ExPASy Swiss-Prot
Match: Q2PMU9 (ATP synthase epsilon chain, chloroplastic OS=Glycine max OX=3847 GN=atpE PE=3 SV=1) HSP 1 Score: 114.4 bits (285), Expect = 7.6e-25 Identity = 59/68 (86.76%), Postives = 63/68 (92.65%), Query Frame = 0
BLAST of Lag0035006 vs. ExPASy Swiss-Prot
Match: Q49KZ2 (ATP synthase epsilon chain, chloroplastic OS=Eucalyptus globulus subsp. globulus OX=71271 GN=atpE PE=3 SV=1) HSP 1 Score: 113.6 bits (283), Expect = 1.3e-24 Identity = 57/70 (81.43%), Postives = 64/70 (91.43%), Query Frame = 0
BLAST of Lag0035006 vs. ExPASy Swiss-Prot
Match: A0ZZ41 (ATP synthase epsilon chain, chloroplastic OS=Gossypium barbadense OX=3634 GN=atpE PE=3 SV=1) HSP 1 Score: 113.6 bits (283), Expect = 1.3e-24 Identity = 58/70 (82.86%), Postives = 63/70 (90.00%), Query Frame = 0
The following BLAST results are available for this feature:
InterPro
Analysis Name: InterPro Annotations of Sponge gourd (AG-4) v1
Date Performed: 2022-08-01
Relationships
The following mRNA feature(s) are a part of this gene:
GO Annotation
GO Assignments
This gene is annotated with the following GO terms.
|