
IVF0017891 (gene) Melon (IVF77) v1
Overview
Sequences
The following sequences are available for this feature:
Legend: exonCDSpolypeptide Hold the cursor over a type above to highlight its positions in the sequence below.ATGGTTCTCAAGTATCAGTTAGTTCTTGAAGATCTTGATGTTTTGGTCTCTGTAAGGTCTGATGAGGATTTAAAGCATGGCTTGATGAGTATGATTGCCTAGAAAGTGAAGGAAAGCTTCAATGTTTCTTATTTCCTTCAAATCCAAATTTCATTAAGGCTCAACCATTCTCCTCAAATCCCCAGCAAATCGAGCAACGTTATTTTGAAGCTATCAATGGCATTGTATGGTCTGGCTCCTTTGCCAATGTAAAACTCTCCCGTAGTACCGCTAACTGA ATGGTTCTCAAGTATCAGTTAGTTCTTGAAGATCTTGATGTTTTGGTCTCTGTAAGGTCTGATGAGGATTTAAAGCATGGAAAGCTTCAATGTTTCTTATTTCCTTCAAATCCAAATTTCATTAAGGCTCAACCATTCTCCTCAAATCCCCAGCAAATCGAGCAACGTTATTTTGAAGCTATCAATGGCATTGTATGGTCTGGCTCCTTTGCCAATGTAAAACTCTCCCGTAGTACCGCTAACTGA ATGGTTCTCAAGTATCAGTTAGTTCTTGAAGATCTTGATGTTTTGGTCTCTGTAAGGTCTGATGAGGATTTAAAGCATGGAAAGCTTCAATGTTTCTTATTTCCTTCAAATCCAAATTTCATTAAGGCTCAACCATTCTCCTCAAATCCCCAGCAAATCGAGCAACGTTATTTTGAAGCTATCAATGGCATTGTATGGTCTGGCTCCTTTGCCAATGTAAAACTCTCCCGTAGTACCGCTAACTGA MVLKYQLVLEDLDVLVSVRSDEDLKHGKLQCFLFPSNPNFIKAQPFSSNPQQIEQRYFEAINGIVWSGSFANVKLSRSTAN Homology
BLAST of IVF0017891 vs. ExPASy TrEMBL
Match: A0A5D3E246 (Octicosapeptide/Phox/Bem1p domain-containing family protein OS=Cucumis melo var. makuwa OX=1194695 GN=E5676_scaffold588G00090 PE=4 SV=1) HSP 1 Score: 152.9 bits (385), Expect = 5.7e-34 Identity = 80/92 (86.96%), Postives = 80/92 (86.96%), Query Frame = 0
BLAST of IVF0017891 vs. ExPASy TrEMBL
Match: A0A5A7UL31 (Octicosapeptide/Phox/Bem1p domain-containing family protein OS=Cucumis melo var. makuwa OX=1194695 GN=E5676_scaffold106G00210 PE=4 SV=1) HSP 1 Score: 150.6 bits (379), Expect = 2.8e-33 Identity = 78/92 (84.78%), Postives = 79/92 (85.87%), Query Frame = 0
BLAST of IVF0017891 vs. ExPASy TrEMBL
Match: A0A5A7U7T5 (PB1 domain-containing protein OS=Cucumis melo var. makuwa OX=1194695 GN=E6C27_scaffold60G002390 PE=4 SV=1) HSP 1 Score: 146.7 bits (369), Expect = 4.1e-32 Identity = 77/92 (83.70%), Postives = 78/92 (84.78%), Query Frame = 0
BLAST of IVF0017891 vs. ExPASy TrEMBL
Match: A0A5A7T2V3 (Octicosapeptide/Phox/Bem1p domain-containing family protein OS=Cucumis melo var. makuwa OX=1194695 GN=E6C27_scaffold918G00140 PE=4 SV=1) HSP 1 Score: 137.5 bits (345), Expect = 2.5e-29 Identity = 76/92 (82.61%), Postives = 76/92 (82.61%), Query Frame = 0
BLAST of IVF0017891 vs. ExPASy TrEMBL
Match: A0A5A7T3H0 (Tub domain-containing protein OS=Cucumis melo var. makuwa OX=1194695 GN=E6C27_scaffold36G00470 PE=3 SV=1) HSP 1 Score: 119.4 bits (298), Expect = 7.0e-24 Identity = 60/75 (80.00%), Postives = 62/75 (82.67%), Query Frame = 0
BLAST of IVF0017891 vs. NCBI nr
Match: KAA0053093.1 (octicosapeptide/Phox/Bem1p domain-containing family protein [Cucumis melo var. makuwa] >KAA0065720.1 octicosapeptide/Phox/Bem1p domain-containing family protein [Cucumis melo var. makuwa] >TYK29946.1 octicosapeptide/Phox/Bem1p domain-containing family protein [Cucumis melo var. makuwa]) HSP 1 Score: 151 bits (381), Expect = 1.21e-45 Identity = 80/92 (86.96%), Postives = 80/92 (86.96%), Query Frame = 0
BLAST of IVF0017891 vs. NCBI nr
Match: KAA0056522.1 (octicosapeptide/Phox/Bem1p domain-containing family protein [Cucumis melo var. makuwa] >TYK12092.1 octicosapeptide/Phox/Bem1p domain-containing family protein [Cucumis melo var. makuwa]) HSP 1 Score: 149 bits (375), Expect = 9.98e-45 Identity = 78/92 (84.78%), Postives = 79/92 (85.87%), Query Frame = 0
BLAST of IVF0017891 vs. NCBI nr
Match: KAA0051822.1 (hypothetical protein E6C27_scaffold60G002390 [Cucumis melo var. makuwa]) HSP 1 Score: 145 bits (365), Expect = 3.35e-43 Identity = 77/92 (83.70%), Postives = 78/92 (84.78%), Query Frame = 0
BLAST of IVF0017891 vs. NCBI nr
Match: KAA0037802.1 (octicosapeptide/Phox/Bem1p domain-containing family protein [Cucumis melo var. makuwa]) HSP 1 Score: 135 bits (341), Expect = 1.53e-39 Identity = 76/92 (82.61%), Postives = 76/92 (82.61%), Query Frame = 0
BLAST of IVF0017891 vs. NCBI nr
Match: KAA0037880.1 (uncharacterized protein E6C27_scaffold36G00470 [Cucumis melo var. makuwa]) HSP 1 Score: 119 bits (297), Expect = 8.68e-32 Identity = 60/75 (80.00%), Postives = 62/75 (82.67%), Query Frame = 0
BLAST of IVF0017891 vs. TAIR 10
Match: AT5G49920.1 (Octicosapeptide/Phox/Bem1p family protein ) HSP 1 Score: 77.0 bits (188), Expect = 7.6e-15 Identity = 41/75 (54.67%), Postives = 52/75 (69.33%), Query Frame = 0
BLAST of IVF0017891 vs. TAIR 10
Match: AT3G46920.1 (Protein kinase superfamily protein with octicosapeptide/Phox/Bem1p domain ) HSP 1 Score: 44.3 bits (103), Expect = 5.5e-05 Identity = 33/87 (37.93%), Postives = 45/87 (51.72%), Query Frame = 0
BLAST of IVF0017891 vs. TAIR 10
Match: AT2G35050.1 (Protein kinase superfamily protein with octicosapeptide/Phox/Bem1p domain ) HSP 1 Score: 42.7 bits (99), Expect = 1.6e-04 Identity = 25/56 (44.64%), Postives = 33/56 (58.93%), Query Frame = 0
BLAST of IVF0017891 vs. TAIR 10
Match: AT5G64430.1 (Octicosapeptide/Phox/Bem1p family protein ) HSP 1 Score: 42.7 bits (99), Expect = 1.6e-04 Identity = 26/79 (32.91%), Postives = 40/79 (50.63%), Query Frame = 0
BLAST of IVF0017891 vs. TAIR 10
Match: AT5G09620.1 (Octicosapeptide/Phox/Bem1p family protein ) HSP 1 Score: 40.8 bits (94), Expect = 6.1e-04 Identity = 22/50 (44.00%), Postives = 29/50 (58.00%), Query Frame = 0
The following BLAST results are available for this feature:
InterPro
Analysis Name: InterPro Annotations of Melon (IVF77) v1
Date Performed: 2021-10-25 Position : 0 Zoom : x 1
Relationships
The following mRNA feature(s) are a part of this gene:
GO Annotation
GO Assignments
This gene is annotated with the following GO terms.
|