
HG10008180 (gene) Bottle gourd (Hangzhou Gourd) v1
Overview
Sequences
The following sequences are available for this feature:
Legend: CDSpolypeptide Hold the cursor over a type above to highlight its positions in the sequence below.ATGACCTTAAATCTTAGTGTCCTGACTCCGAATCGAATTATTTGGGATTCAGAAGTGAAAGAAATCATTTTAGTTACGAATAGTGGCCAAATTGGTGTATTACCAGATCACGCACCTATTGCCACAGCTGTAGATATAGGTATTTTGAAAATAGGCCTTACTCCTAATGACGGATGGTTAACGATGGCTCTGATGGGTGGTTTTGCTAGAATAGGCAATAATGAGGTCACTATTTTAGTAAATGATGCGGAGAAGGCTAGTGACATTGATCCACAAGAAGCTCAGCAAACTCTTGAAATAGCGGAAGCTAACTTGAGGAAAGCTCAAGGCAAGAGACAAACAATCGAGGCAAATTTAGCTCTCAGACGAGCTAGGACACGAGTAGAGGCTATCAATGGCGTACCAAGTTAA ATGACCTTAAATCTTAGTGTCCTGACTCCGAATCGAATTATTTGGGATTCAGAAGTGAAAGAAATCATTTTAGTTACGAATAGTGGCCAAATTGGTGTATTACCAGATCACGCACCTATTGCCACAGCTGTAGATATAGGTATTTTGAAAATAGGCCTTACTCCTAATGACGGATGGTTAACGATGGCTCTGATGGGTGGTTTTGCTAGAATAGGCAATAATGAGGTCACTATTTTAGTAAATGATGCGGAGAAGGCTAGTGACATTGATCCACAAGAAGCTCAGCAAACTCTTGAAATAGCGGAAGCTAACTTGAGGAAAGCTCAAGGCAAGAGACAAACAATCGAGGCAAATTTAGCTCTCAGACGAGCTAGGACACGAGTAGAGGCTATCAATGGCGTACCAAGTTAA ATGACCTTAAATCTTAGTGTCCTGACTCCGAATCGAATTATTTGGGATTCAGAAGTGAAAGAAATCATTTTAGTTACGAATAGTGGCCAAATTGGTGTATTACCAGATCACGCACCTATTGCCACAGCTGTAGATATAGGTATTTTGAAAATAGGCCTTACTCCTAATGACGGATGGTTAACGATGGCTCTGATGGGTGGTTTTGCTAGAATAGGCAATAATGAGGTCACTATTTTAGTAAATGATGCGGAGAAGGCTAGTGACATTGATCCACAAGAAGCTCAGCAAACTCTTGAAATAGCGGAAGCTAACTTGAGGAAAGCTCAAGGCAAGAGACAAACAATCGAGGCAAATTTAGCTCTCAGACGAGCTAGGACACGAGTAGAGGCTATCAATGGCGTACCAAGTTAA MTLNLSVLTPNRIIWDSEVKEIILVTNSGQIGVLPDHAPIATAVDIGILKIGLTPNDGWLTMALMGGFARIGNNEVTILVNDAEKASDIDPQEAQQTLEIAEANLRKAQGKRQTIEANLALRRARTRVEAINGVPS Homology
BLAST of HG10008180 vs. NCBI nr
Match: YP_004841789.1 (ATP synthase CF1 epsilon subunit [Cucumis melo subsp. melo] >YP_009004050.1 ATP synthase CF1 epsilon subunit [Cucumis hystrix] >YP_009317392.1 ATP synthase CF1 epsilon subunit [Coccinia grandis] >YP_009325995.1 ATP synthase CF1 epsilon subunit [Citrullus lanatus] >YP_009348037.1 ATP synthase CF1 epsilon subunit [Citrullus mucosospermus] >YP_009420800.1 ATP synthase CF1 epsilon subunit [Citrullus colocynthis] >YP_009431563.1 ATP synthase CF1 epsilon subunit [Citrullus amarus] >YP_009431648.1 ATP synthase CF1 epsilon subunit [Citrullus rehmii] >YP_009456152.1 ATP synthase CF1 epsilon subunit [Lagenaria siceraria] >YP_009860079.1 ATP synthase CF1 epsilon subunit [Cucumis melo subsp. agrestis] >YP_247605.1 ATP synthase CF1 epsilon subunit [Cucumis sativus] >Q4VZG9.1 RecName: Full=ATP synthase epsilon chain, chloroplastic; AltName: Full=ATP synthase F1 sector epsilon subunit; AltName: Full=F-ATPase epsilon subunit [Cucumis sativus] >ALF03307.1 ATP synthase CF1 epsilon subunit [Cucumis sativus var. hardwickii] >APW82467.1 ATP synthase CF1 epsilon subunit [Citrullus lanatus subsp. vulgaris] >ASY96590.1 ATP synthase CF1 epsilon subunit [Cucumis melo var. conomon] >ASY96677.1 ATP synthase CF1 epsilon subunit [Cucumis melo var. makuwa] >ASY96764.1 ATP synthase CF1 epsilon subunit [Cucumis melo var. momordica] >ASY96851.1 ATP synthase CF1 epsilon subunit [Cucumis melo var. dudaim] >ASY96938.1 ATP synthase CF1 epsilon subunit [Cucumis melo var. cantalupo] >ASY97112.1 ATP synthase CF1 epsilon subunit [Cucumis melo var. inodorus] >ASY97286.1 ATP synthase CF1 epsilon subunit [Cucumis melo var. flexuosus] >AVE15337.1 AtpE [Cucumis sativus var. sativus] >QJF46389.1 ATP synthase CF1 epsilon subunit [Cucumis melo] >QNM38537.1 ATP synthase CF1 epsilon subunit [Lagenaria siceraria var. microcarpa] >QZL38599.1 CF1 subunit epsilon [Citrullus naudinianus] >QZL38687.1 CF1 subunit epsilon [Citrullus ecirrhosus]) HSP 1 Score: 256.5 bits (654), Expect = 1.3e-64 Identity = 135/136 (99.26%), Postives = 135/136 (99.26%), Query Frame = 0
BLAST of HG10008180 vs. NCBI nr
Match: YP_009346490.1 (ATP synthase CF1 epsilon subunit [Cucumis x hytivus] >AOW71100.1 ATP synthase CF1 epsilon subunit [Cucumis x hytivus] >QCY72848.1 AtpE [Cucumis hystrix]) HSP 1 Score: 255.4 bits (651), Expect = 2.8e-64 Identity = 134/136 (98.53%), Postives = 135/136 (99.26%), Query Frame = 0
BLAST of HG10008180 vs. NCBI nr
Match: ASY96329.1 (ATP synthase CF1 epsilon subunit [Cucumis melo subsp. agrestis]) HSP 1 Score: 254.6 bits (649), Expect = 4.8e-64 Identity = 134/136 (98.53%), Postives = 134/136 (98.53%), Query Frame = 0
BLAST of HG10008180 vs. NCBI nr
Match: YP_010131100.1 (ATP synthase CF1 epsilon subunit [Benincasa hispida] >QPZ75747.1 ATP synthase CF1 epsilon subunit [Benincasa hispida] >QSQ72316.1 CF1 subunit epsilon [Benincasa hispida]) HSP 1 Score: 252.7 bits (644), Expect = 1.8e-63 Identity = 133/136 (97.79%), Postives = 134/136 (98.53%), Query Frame = 0
BLAST of HG10008180 vs. NCBI nr
Match: YP_009752081.1 (CF1 subunit epsilon [Dendrosicyos socotranus] >YP_009753095.1 CF1 subunit epsilon [Corallocarpus boehmii] >QIT05491.1 CF1 subunit epsilon [Dendrosicyos socotranus] >QIT06167.1 CF1 subunit epsilon [Corallocarpus boehmii]) HSP 1 Score: 250.4 bits (638), Expect = 9.1e-63 Identity = 132/136 (97.06%), Postives = 134/136 (98.53%), Query Frame = 0
BLAST of HG10008180 vs. ExPASy Swiss-Prot
Match: Q4VZG9 (ATP synthase epsilon chain, chloroplastic OS=Cucumis sativus OX=3659 GN=atpE PE=3 SV=1) HSP 1 Score: 256.5 bits (654), Expect = 1.7e-67 Identity = 135/136 (99.26%), Postives = 135/136 (99.26%), Query Frame = 0
BLAST of HG10008180 vs. ExPASy Swiss-Prot
Match: A0ZZ41 (ATP synthase epsilon chain, chloroplastic OS=Gossypium barbadense OX=3634 GN=atpE PE=3 SV=1) HSP 1 Score: 223.8 bits (569), Expect = 1.2e-57 Identity = 119/134 (88.81%), Postives = 125/134 (93.28%), Query Frame = 0
BLAST of HG10008180 vs. ExPASy Swiss-Prot
Match: Q2L911 (ATP synthase epsilon chain, chloroplastic OS=Gossypium hirsutum OX=3635 GN=atpE PE=3 SV=1) HSP 1 Score: 223.8 bits (569), Expect = 1.2e-57 Identity = 119/134 (88.81%), Postives = 125/134 (93.28%), Query Frame = 0
BLAST of HG10008180 vs. ExPASy Swiss-Prot
Match: Q49KZ2 (ATP synthase epsilon chain, chloroplastic OS=Eucalyptus globulus subsp. globulus OX=71271 GN=atpE PE=3 SV=1) HSP 1 Score: 222.6 bits (566), Expect = 2.7e-57 Identity = 117/134 (87.31%), Postives = 126/134 (94.03%), Query Frame = 0
BLAST of HG10008180 vs. ExPASy Swiss-Prot
Match: Q1KXV3 (ATP synthase epsilon chain, chloroplastic OS=Helianthus annuus OX=4232 GN=atpE PE=3 SV=1) HSP 1 Score: 222.6 bits (566), Expect = 2.7e-57 Identity = 118/134 (88.06%), Postives = 126/134 (94.03%), Query Frame = 0
BLAST of HG10008180 vs. ExPASy TrEMBL
Match: A0A218KG49 (ATP synthase epsilon chain, chloroplastic OS=Cucumis sativus var. hardwickii OX=319220 GN=atpE PE=3 SV=1) HSP 1 Score: 256.5 bits (654), Expect = 6.1e-65 Identity = 135/136 (99.26%), Postives = 135/136 (99.26%), Query Frame = 0
BLAST of HG10008180 vs. ExPASy TrEMBL
Match: G3ETZ1 (ATP synthase epsilon chain, chloroplastic OS=Cucumis melo subsp. melo OX=412675 GN=atpE PE=3 SV=1) HSP 1 Score: 256.5 bits (654), Expect = 6.1e-65 Identity = 135/136 (99.26%), Postives = 135/136 (99.26%), Query Frame = 0
BLAST of HG10008180 vs. ExPASy TrEMBL
Match: A0A1X9Q1L0 (ATP synthase epsilon chain, chloroplastic OS=Cucumis sativus OX=3659 GN=atpE PE=3 SV=1) HSP 1 Score: 256.5 bits (654), Expect = 6.1e-65 Identity = 135/136 (99.26%), Postives = 135/136 (99.26%), Query Frame = 0
BLAST of HG10008180 vs. ExPASy TrEMBL
Match: A0A249RZA2 (ATP synthase epsilon chain, chloroplastic OS=Cucumis melo var. cantalupensis OX=3658 GN=atpE PE=3 SV=1) HSP 1 Score: 256.5 bits (654), Expect = 6.1e-65 Identity = 135/136 (99.26%), Postives = 135/136 (99.26%), Query Frame = 0
BLAST of HG10008180 vs. ExPASy TrEMBL
Match: A0A1S4EU14 (ATP synthase epsilon chain, chloroplastic OS=Cucumis melo OX=3656 GN=atpE PE=3 SV=1) HSP 1 Score: 256.5 bits (654), Expect = 6.1e-65 Identity = 135/136 (99.26%), Postives = 135/136 (99.26%), Query Frame = 0
BLAST of HG10008180 vs. TAIR 10
Match: ATCG00470.1 (ATP synthase epsilon chain ) HSP 1 Score: 217.2 bits (552), Expect = 7.9e-57 Identity = 117/134 (87.31%), Postives = 124/134 (92.54%), Query Frame = 0
The following BLAST results are available for this feature:
InterPro
Analysis Name: InterPro Annotations of Bottle gourd (Hangzhou Gourd) v1
Date Performed: 2022-08-01 Position : 0 Zoom : x 1
Relationships
The following mRNA feature(s) are a part of this gene:
GO Annotation
GO Assignments
This gene is annotated with the following GO terms.
|