CmoCh04G028160 (gene) Cucurbita moschata (Rifu) v1
Overview
Sequences
The following sequences are available for this feature:
Legend: exonCDSpolypeptide Hold the cursor over a type above to highlight its positions in the sequence below.ATGGGGTTTTCAAAGAAGTCCCAAATCGACGGCGGATTTGAAGCAGAGTCCAAAAAATGGGTAATCGCTGGCTTGCCGGCGAGGTCGTCGTTGAAGCAGATAAACACAAAACCGAAGGTGAAAGACGGCGATGACGACGGCGAGAGGTCGTGTTCGACGACGCCGACAGCGAAAGAAGCAAGAATACCGGAGAAACTGAGCTGTCCGCCGGCGCCGAGAAAGCGGAGATCTCGAAAATTAAGCTCGAATCAAAATCACGTGAGGGAGTTCTTCCAACCTTCGGATTTAGAATCCGTCTTCAAACTCCTAGTTTAG ATGGGGTTTTCAAAGAAGTCCCAAATCGACGGCGGATTTGAAGCAGAGTCCAAAAAATGGGTAATCGCTGGCTTGCCGGCGAGGTCGTCGTTGAAGCAGATAAACACAAAACCGAAGGTGAAAGACGGCGATGACGACGGCGAGAGGTCGTGTTCGACGACGCCGACAGCGAAAGAAGCAAGAATACCGGAGAAACTGAGCTGTCCGCCGGCGCCGAGAAAGCGGAGATCTCGAAAATTAAGCTCGAATCAAAATCACGTGAGGGAGTTCTTCCAACCTTCGGATTTAGAATCCGTCTTCAAACTCCTAGTTTAG ATGGGGTTTTCAAAGAAGTCCCAAATCGACGGCGGATTTGAAGCAGAGTCCAAAAAATGGGTAATCGCTGGCTTGCCGGCGAGGTCGTCGTTGAAGCAGATAAACACAAAACCGAAGGTGAAAGACGGCGATGACGACGGCGAGAGGTCGTGTTCGACGACGCCGACAGCGAAAGAAGCAAGAATACCGGAGAAACTGAGCTGTCCGCCGGCGCCGAGAAAGCGGAGATCTCGAAAATTAAGCTCGAATCAAAATCACGTGAGGGAGTTCTTCCAACCTTCGGATTTAGAATCCGTCTTCAAACTCCTAGTTTAG MGFSKKSQIDGGFEAESKKWVIAGLPARSSLKQINTKPKVKDGDDDGERSCSTTPTAKEARIPEKLSCPPAPRKRRSRKLSSNQNHVREFFQPSDLESVFKLLV Homology
BLAST of CmoCh04G028160 vs. ExPASy Swiss-Prot
Match: Q29Q81 (Cyclin-dependent protein kinase inhibitor SMR6 OS=Arabidopsis thaliana OX=3702 GN=SMR6 PE=1 SV=1) HSP 1 Score: 109.0 bits (271), Expect = 3.3e-23 Identity = 62/109 (56.88%), Postives = 74/109 (67.89%), Query Frame = 0
BLAST of CmoCh04G028160 vs. ExPASy Swiss-Prot
Match: Q9SAD3 (Cyclin-dependent protein kinase inhibitor SMR8 OS=Arabidopsis thaliana OX=3702 GN=SMR8 PE=1 SV=1) HSP 1 Score: 83.6 bits (205), Expect = 1.5e-15 Identity = 48/104 (46.15%), Postives = 61/104 (58.65%), Query Frame = 0
BLAST of CmoCh04G028160 vs. ExPASy Swiss-Prot
Match: Q1G3Y4 (Cyclin-dependent protein kinase inhibitor SMR15 OS=Arabidopsis thaliana OX=3702 GN=SMR15 PE=3 SV=1) HSP 1 Score: 67.0 bits (162), Expect = 1.4e-10 Identity = 47/105 (44.76%), Postives = 59/105 (56.19%), Query Frame = 0
BLAST of CmoCh04G028160 vs. ExPASy Swiss-Prot
Match: Q9LVX6 (Cyclin-dependent protein kinase inhibitor SMR7 OS=Arabidopsis thaliana OX=3702 GN=SMR7 PE=2 SV=1) HSP 1 Score: 60.8 bits (146), Expect = 1.0e-08 Identity = 39/100 (39.00%), Postives = 52/100 (52.00%), Query Frame = 0
BLAST of CmoCh04G028160 vs. ExPASy TrEMBL
Match: A0A6J1JPL5 (cyclin-dependent protein kinase inhibitor SMR6-like OS=Cucurbita maxima OX=3661 GN=LOC111487749 PE=4 SV=1) HSP 1 Score: 202.6 bits (514), Expect = 8.0e-49 Identity = 101/104 (97.12%), Postives = 102/104 (98.08%), Query Frame = 0
BLAST of CmoCh04G028160 vs. ExPASy TrEMBL
Match: A0A6J1FHD8 (cyclin-dependent protein kinase inhibitor SMR6 OS=Cucurbita moschata OX=3662 GN=LOC111445393 PE=4 SV=1) HSP 1 Score: 169.1 bits (427), Expect = 9.8e-39 Identity = 86/104 (82.69%), Postives = 90/104 (86.54%), Query Frame = 0
BLAST of CmoCh04G028160 vs. ExPASy TrEMBL
Match: A0A6J1JVL3 (cyclin-dependent protein kinase inhibitor SMR6-like OS=Cucurbita maxima OX=3661 GN=LOC111489273 PE=4 SV=1) HSP 1 Score: 164.9 bits (416), Expect = 1.9e-37 Identity = 85/104 (81.73%), Postives = 90/104 (86.54%), Query Frame = 0
BLAST of CmoCh04G028160 vs. ExPASy TrEMBL
Match: A0A5D3BY33 (Uncharacterized protein OS=Cucumis melo var. makuwa OX=1194695 GN=E5676_scaffold374G00180 PE=4 SV=1) HSP 1 Score: 158.3 bits (399), Expect = 1.7e-35 Identity = 82/104 (78.85%), Postives = 87/104 (83.65%), Query Frame = 0
BLAST of CmoCh04G028160 vs. ExPASy TrEMBL
Match: A0A1S3C883 (uncharacterized protein LOC103498100 OS=Cucumis melo OX=3656 GN=LOC103498100 PE=4 SV=1) HSP 1 Score: 158.3 bits (399), Expect = 1.7e-35 Identity = 82/104 (78.85%), Postives = 87/104 (83.65%), Query Frame = 0
BLAST of CmoCh04G028160 vs. NCBI nr
Match: KAG7033096.1 (Cyclin-dependent protein kinase inhibitor SMR6, partial [Cucurbita argyrosperma subsp. argyrosperma]) HSP 1 Score: 207.2 bits (526), Expect = 6.7e-50 Identity = 104/104 (100.00%), Postives = 104/104 (100.00%), Query Frame = 0
BLAST of CmoCh04G028160 vs. NCBI nr
Match: KAG6602418.1 (Cyclin-dependent protein kinase inhibitor SMR6, partial [Cucurbita argyrosperma subsp. sororia]) HSP 1 Score: 204.9 bits (520), Expect = 3.3e-49 Identity = 103/104 (99.04%), Postives = 103/104 (99.04%), Query Frame = 0
BLAST of CmoCh04G028160 vs. NCBI nr
Match: XP_022991036.1 (cyclin-dependent protein kinase inhibitor SMR6-like [Cucurbita maxima]) HSP 1 Score: 202.6 bits (514), Expect = 1.7e-48 Identity = 101/104 (97.12%), Postives = 102/104 (98.08%), Query Frame = 0
BLAST of CmoCh04G028160 vs. NCBI nr
Match: XP_023550994.1 (cyclin-dependent protein kinase inhibitor SMR6 [Cucurbita pepo subsp. pepo]) HSP 1 Score: 169.9 bits (429), Expect = 1.2e-38 Identity = 87/104 (83.65%), Postives = 90/104 (86.54%), Query Frame = 0
BLAST of CmoCh04G028160 vs. NCBI nr
Match: XP_022939509.1 (cyclin-dependent protein kinase inhibitor SMR6 [Cucurbita moschata]) HSP 1 Score: 169.1 bits (427), Expect = 2.0e-38 Identity = 86/104 (82.69%), Postives = 90/104 (86.54%), Query Frame = 0
BLAST of CmoCh04G028160 vs. TAIR 10
Match: AT5G40460.1 (unknown protein; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G27630.1); Has 87 Blast hits to 87 proteins in 12 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 87; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). ) HSP 1 Score: 109.0 bits (271), Expect = 2.3e-24 Identity = 62/109 (56.88%), Postives = 74/109 (67.89%), Query Frame = 0
BLAST of CmoCh04G028160 vs. TAIR 10
Match: AT1G10690.1 (unknown protein; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G60783.1); Has 59 Blast hits to 59 proteins in 9 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 59; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). ) HSP 1 Score: 83.6 bits (205), Expect = 1.0e-16 Identity = 48/104 (46.15%), Postives = 61/104 (58.65%), Query Frame = 0
BLAST of CmoCh04G028160 vs. TAIR 10
Match: AT1G60783.1 (unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G10690.1); Has 30201 Blast hits to 17322 proteins in 780 species: Archae - 12; Bacteria - 1396; Metazoa - 17338; Fungi - 3422; Plants - 5037; Viruses - 0; Other Eukaryotes - 2996 (source: NCBI BLink). ) HSP 1 Score: 67.0 bits (162), Expect = 1.0e-11 Identity = 47/105 (44.76%), Postives = 59/105 (56.19%), Query Frame = 0
BLAST of CmoCh04G028160 vs. TAIR 10
Match: AT3G27630.1 (unknown protein; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G40460.1); Has 36 Blast hits to 36 proteins in 6 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 36; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). ) HSP 1 Score: 60.8 bits (146), Expect = 7.3e-10 Identity = 39/100 (39.00%), Postives = 52/100 (52.00%), Query Frame = 0
BLAST of CmoCh04G028160 vs. TAIR 10
Match: AT3G20898.1 (unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G51355.1); Has 66 Blast hits to 66 proteins in 10 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 66; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). ) HSP 1 Score: 43.5 bits (101), Expect = 1.2e-04 Identity = 22/47 (46.81%), Postives = 30/47 (63.83%), Query Frame = 0
The following BLAST results are available for this feature:
InterPro
Analysis Name: InterPro Annotations of Cucurbita moschata (Rifu) v1
Date Performed: 2021-10-25
Relationships
The following mRNA feature(s) are a part of this gene:
GO Annotation
GO Assignments
This gene is annotated with the following GO terms.
|