
Carg26894 (gene) Silver-seed gourd (SMH-JMG-627) v2
Overview
Sequences
The following sequences are available for this feature:
Legend: exonCDSpolypeptide Hold the cursor over a type above to highlight its positions in the sequence below.ATGGATCCAGAGGCTGCACGAACGGCTCGGGAATCGCTAGACCTTGCATTTCATATGTGTAACGTAATCGATGCCGGGATCGATCGCCACACCCTCTCTGTCCTTATTGCACTCTGTGACATGGGTGTGAACCCTGAAGCACTGGCTGCTGTTGTCAAGGAACTAAGCAGAGAACCGCCCTCATCGGAAACCATCATCTCAGGTAACAAGTCATAACCTATATGCAAAGAAACAACTCTGTTCTTCTTGTGATGATGGTTGCTAAAGTTGATATCTATGTGTTTTTAAACCACTTTACTATATATGTAGCTTACTTGTTTACTATATATGTAGCTTACTTGGATCTTGTGAGATGA ATGGATCCAGAGGCTGCACGAACGGCTCGGGAATCGCTAGACCTTGCATTTCATATGTGTAACGTAATCGATGCCGGGATCGATCGCCACACCCTCTCTGTCCTTATTGCACTCTGTGACATGGGTGTGAACCCTGAAGCACTGGCTGCTGTTGTCAAGGAACTAAGCAGAGAACCGCCCTCATCGGAAACCATCATCTCAGCTTACTTGGATCTTGTGAGATGA ATGGATCCAGAGGCTGCACGAACGGCTCGGGAATCGCTAGACCTTGCATTTCATATGTGTAACGTAATCGATGCCGGGATCGATCGCCACACCCTCTCTGTCCTTATTGCACTCTGTGACATGGGTGTGAACCCTGAAGCACTGGCTGCTGTTGTCAAGGAACTAAGCAGAGAACCGCCCTCATCGGAAACCATCATCTCAGCTTACTTGGATCTTGTGAGATGA MDPEAARTARESLDLAFHMCNVIDAGIDRHTLSVLIALCDMGVNPEALAAVVKELSREPPSSETIISAYLDLVR Homology
BLAST of Carg26894 vs. NCBI nr
Match: KAG7029927.1 (Mitotic-spindle organizing protein 1B, partial [Cucurbita argyrosperma subsp. argyrosperma]) HSP 1 Score: 146.7 bits (369), Expect = 7.7e-32 Identity = 74/74 (100.00%), Postives = 74/74 (100.00%), Query Frame = 0
BLAST of Carg26894 vs. NCBI nr
Match: KAG6598967.1 (ALBINO3-like protein 3, mitochondrial, partial [Cucurbita argyrosperma subsp. sororia]) HSP 1 Score: 132.5 bits (332), Expect = 1.5e-27 Identity = 66/67 (98.51%), Postives = 67/67 (100.00%), Query Frame = 0
BLAST of Carg26894 vs. NCBI nr
Match: XP_022973921.1 (mitotic-spindle organizing protein 1B-like [Cucurbita maxima] >XP_022973922.1 mitotic-spindle organizing protein 1B-like [Cucurbita maxima]) HSP 1 Score: 126.7 bits (317), Expect = 8.2e-26 Identity = 64/67 (95.52%), Postives = 65/67 (97.01%), Query Frame = 0
BLAST of Carg26894 vs. NCBI nr
Match: XP_038889535.1 (mitotic-spindle organizing protein 1B [Benincasa hispida] >XP_038889536.1 mitotic-spindle organizing protein 1B [Benincasa hispida]) HSP 1 Score: 126.3 bits (316), Expect = 1.1e-25 Identity = 62/68 (91.18%), Postives = 66/68 (97.06%), Query Frame = 0
BLAST of Carg26894 vs. NCBI nr
Match: KAE8651738.1 (hypothetical protein Csa_006450 [Cucumis sativus]) HSP 1 Score: 125.6 bits (314), Expect = 1.8e-25 Identity = 63/74 (85.14%), Postives = 67/74 (90.54%), Query Frame = 0
BLAST of Carg26894 vs. ExPASy Swiss-Prot
Match: Q9M0N8 (Mitotic-spindle organizing protein 1B OS=Arabidopsis thaliana OX=3702 GN=GIP1 PE=1 SV=1) HSP 1 Score: 94.4 bits (233), Expect = 5.9e-19 Identity = 48/65 (73.85%), Postives = 54/65 (83.08%), Query Frame = 0
BLAST of Carg26894 vs. ExPASy Swiss-Prot
Match: Q9C9T3 (Mitotic-spindle organizing protein 1A OS=Arabidopsis thaliana OX=3702 GN=GIP2 PE=1 SV=1) HSP 1 Score: 88.2 bits (217), Expect = 4.3e-17 Identity = 41/66 (62.12%), Postives = 54/66 (81.82%), Query Frame = 0
BLAST of Carg26894 vs. ExPASy Swiss-Prot
Match: A9NKD9 (Mitotic-spindle organizing protein 1 OS=Picea sitchensis OX=3332 PE=3 SV=1) HSP 1 Score: 84.7 bits (208), Expect = 4.7e-16 Identity = 42/58 (72.41%), Postives = 48/58 (82.76%), Query Frame = 0
BLAST of Carg26894 vs. ExPASy Swiss-Prot
Match: B5FXZ4 (Mitotic-spindle organizing protein 1 OS=Taeniopygia guttata OX=59729 GN=mzt1 PE=3 SV=1) HSP 1 Score: 56.2 bits (134), Expect = 1.8e-07 Identity = 21/48 (43.75%), Postives = 37/48 (77.08%), Query Frame = 0
BLAST of Carg26894 vs. ExPASy Swiss-Prot
Match: Q0VFD6 (Mitotic-spindle organizing protein 1 OS=Xenopus tropicalis OX=8364 GN=mzt1 PE=3 SV=1) HSP 1 Score: 55.5 bits (132), Expect = 3.1e-07 Identity = 24/56 (42.86%), Postives = 41/56 (73.21%), Query Frame = 0
BLAST of Carg26894 vs. ExPASy TrEMBL
Match: A0A6J1I8U7 (mitotic-spindle organizing protein 1B-like OS=Cucurbita maxima OX=3661 GN=LOC111472550 PE=3 SV=1) HSP 1 Score: 126.7 bits (317), Expect = 4.0e-26 Identity = 64/67 (95.52%), Postives = 65/67 (97.01%), Query Frame = 0
BLAST of Carg26894 vs. ExPASy TrEMBL
Match: A0A5D3D1N9 (Mitotic-spindle organizing protein 1A-like OS=Cucumis melo var. makuwa OX=1194695 GN=E5676_scaffold434G003990 PE=3 SV=1) HSP 1 Score: 122.5 bits (306), Expect = 7.5e-25 Identity = 62/68 (91.18%), Postives = 65/68 (95.59%), Query Frame = 0
BLAST of Carg26894 vs. ExPASy TrEMBL
Match: A0A0A0LMZ6 (Uncharacterized protein OS=Cucumis sativus OX=3659 GN=Csa_2G094370 PE=3 SV=1) HSP 1 Score: 122.5 bits (306), Expect = 7.5e-25 Identity = 61/68 (89.71%), Postives = 65/68 (95.59%), Query Frame = 0
BLAST of Carg26894 vs. ExPASy TrEMBL
Match: A0A6J1DE95 (mitotic-spindle organizing protein 1B OS=Momordica charantia OX=3673 GN=LOC111019635 PE=3 SV=1) HSP 1 Score: 120.9 bits (302), Expect = 2.2e-24 Identity = 59/67 (88.06%), Postives = 63/67 (94.03%), Query Frame = 0
BLAST of Carg26894 vs. ExPASy TrEMBL
Match: A0A1S3B468 (mitotic-spindle organizing protein 1A-like OS=Cucumis melo OX=3656 GN=LOC103485818 PE=3 SV=1) HSP 1 Score: 119.8 bits (299), Expect = 4.9e-24 Identity = 60/68 (88.24%), Postives = 64/68 (94.12%), Query Frame = 0
BLAST of Carg26894 vs. TAIR 10
Match: AT4G09550.1 (AtGCP3 interacting protein 1 ) HSP 1 Score: 94.4 bits (233), Expect = 4.2e-20 Identity = 48/65 (73.85%), Postives = 54/65 (83.08%), Query Frame = 0
BLAST of Carg26894 vs. TAIR 10
Match: AT1G73790.1 (Protein of unknown function (DUF3743) ) HSP 1 Score: 88.2 bits (217), Expect = 3.0e-18 Identity = 41/66 (62.12%), Postives = 54/66 (81.82%), Query Frame = 0
The following BLAST results are available for this feature:
InterPro
Analysis Name: InterPro Annotations of Silver-seed gourd (SMH-JMG-627) v2
Date Performed: 2021-10-25 Position : 0 Zoom : x 1
Relationships
The following mRNA feature(s) are a part of this gene:
GO Annotation
GO Assignments
This gene is annotated with the following GO terms.
|